ID: 1016173704

View in Genome Browser
Species Human (GRCh38)
Location 6:141051772-141051794
Sequence GTCTCTGCCTAGTTTATGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016173704_1016173708 20 Left 1016173704 6:141051772-141051794 CCAAACATAAACTAGGCAGAGAC No data
Right 1016173708 6:141051815-141051837 ATAAAGATCCTATACGTGGAAGG No data
1016173704_1016173705 -5 Left 1016173704 6:141051772-141051794 CCAAACATAAACTAGGCAGAGAC No data
Right 1016173705 6:141051790-141051812 GAGACATGCTAAGCCTTTTAAGG No data
1016173704_1016173707 16 Left 1016173704 6:141051772-141051794 CCAAACATAAACTAGGCAGAGAC No data
Right 1016173707 6:141051811-141051833 GGAAATAAAGATCCTATACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016173704 Original CRISPR GTCTCTGCCTAGTTTATGTT TGG (reversed) Intergenic
No off target data available for this crispr