ID: 1016174914

View in Genome Browser
Species Human (GRCh38)
Location 6:141069085-141069107
Sequence GACAGTTCTTGGCCTGTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016174914_1016174917 11 Left 1016174914 6:141069085-141069107 CCAGTAACAGGCCAAGAACTGTC No data
Right 1016174917 6:141069119-141069141 GAGTAGTTATTTGCAGAAGATGG 0: 11
1: 189
2: 190
3: 139
4: 322

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016174914 Original CRISPR GACAGTTCTTGGCCTGTTAC TGG (reversed) Intergenic
No off target data available for this crispr