ID: 1016175738

View in Genome Browser
Species Human (GRCh38)
Location 6:141075735-141075757
Sequence GCAGACATTTTCCCAAACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016175738_1016175743 26 Left 1016175738 6:141075735-141075757 CCTGGGTTTGGGAAAATGTCTGC No data
Right 1016175743 6:141075784-141075806 ACATCTCCAGTCTTCTCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016175738 Original CRISPR GCAGACATTTTCCCAAACCC AGG (reversed) Intergenic
No off target data available for this crispr