ID: 1016175740

View in Genome Browser
Species Human (GRCh38)
Location 6:141075765-141075787
Sequence ATGTTGTAGGGAAAGACACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016175740_1016175743 -4 Left 1016175740 6:141075765-141075787 CCTGGTGTCTTTCCCTACAACAT No data
Right 1016175743 6:141075784-141075806 ACATCTCCAGTCTTCTCCCCAGG No data
1016175740_1016175751 14 Left 1016175740 6:141075765-141075787 CCTGGTGTCTTTCCCTACAACAT No data
Right 1016175751 6:141075802-141075824 CCAGGTTAGCTCTAGGGCTTGGG No data
1016175740_1016175745 7 Left 1016175740 6:141075765-141075787 CCTGGTGTCTTTCCCTACAACAT No data
Right 1016175745 6:141075795-141075817 CTTCTCCCCAGGTTAGCTCTAGG No data
1016175740_1016175746 8 Left 1016175740 6:141075765-141075787 CCTGGTGTCTTTCCCTACAACAT No data
Right 1016175746 6:141075796-141075818 TTCTCCCCAGGTTAGCTCTAGGG No data
1016175740_1016175749 13 Left 1016175740 6:141075765-141075787 CCTGGTGTCTTTCCCTACAACAT No data
Right 1016175749 6:141075801-141075823 CCCAGGTTAGCTCTAGGGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016175740 Original CRISPR ATGTTGTAGGGAAAGACACC AGG (reversed) Intergenic