ID: 1016175741

View in Genome Browser
Species Human (GRCh38)
Location 6:141075777-141075799
Sequence AGAAGACTGGAGATGTTGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016175741_1016175749 1 Left 1016175741 6:141075777-141075799 CCCTACAACATCTCCAGTCTTCT No data
Right 1016175749 6:141075801-141075823 CCCAGGTTAGCTCTAGGGCTTGG No data
1016175741_1016175751 2 Left 1016175741 6:141075777-141075799 CCCTACAACATCTCCAGTCTTCT No data
Right 1016175751 6:141075802-141075824 CCAGGTTAGCTCTAGGGCTTGGG No data
1016175741_1016175746 -4 Left 1016175741 6:141075777-141075799 CCCTACAACATCTCCAGTCTTCT No data
Right 1016175746 6:141075796-141075818 TTCTCCCCAGGTTAGCTCTAGGG No data
1016175741_1016175745 -5 Left 1016175741 6:141075777-141075799 CCCTACAACATCTCCAGTCTTCT No data
Right 1016175745 6:141075795-141075817 CTTCTCCCCAGGTTAGCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016175741 Original CRISPR AGAAGACTGGAGATGTTGTA GGG (reversed) Intergenic
No off target data available for this crispr