ID: 1016175746

View in Genome Browser
Species Human (GRCh38)
Location 6:141075796-141075818
Sequence TTCTCCCCAGGTTAGCTCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016175741_1016175746 -4 Left 1016175741 6:141075777-141075799 CCCTACAACATCTCCAGTCTTCT No data
Right 1016175746 6:141075796-141075818 TTCTCCCCAGGTTAGCTCTAGGG No data
1016175740_1016175746 8 Left 1016175740 6:141075765-141075787 CCTGGTGTCTTTCCCTACAACAT No data
Right 1016175746 6:141075796-141075818 TTCTCCCCAGGTTAGCTCTAGGG No data
1016175742_1016175746 -5 Left 1016175742 6:141075778-141075800 CCTACAACATCTCCAGTCTTCTC No data
Right 1016175746 6:141075796-141075818 TTCTCCCCAGGTTAGCTCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016175746 Original CRISPR TTCTCCCCAGGTTAGCTCTA GGG Intergenic
No off target data available for this crispr