ID: 1016175749

View in Genome Browser
Species Human (GRCh38)
Location 6:141075801-141075823
Sequence CCCAGGTTAGCTCTAGGGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016175741_1016175749 1 Left 1016175741 6:141075777-141075799 CCCTACAACATCTCCAGTCTTCT No data
Right 1016175749 6:141075801-141075823 CCCAGGTTAGCTCTAGGGCTTGG No data
1016175742_1016175749 0 Left 1016175742 6:141075778-141075800 CCTACAACATCTCCAGTCTTCTC No data
Right 1016175749 6:141075801-141075823 CCCAGGTTAGCTCTAGGGCTTGG No data
1016175740_1016175749 13 Left 1016175740 6:141075765-141075787 CCTGGTGTCTTTCCCTACAACAT No data
Right 1016175749 6:141075801-141075823 CCCAGGTTAGCTCTAGGGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016175749 Original CRISPR CCCAGGTTAGCTCTAGGGCT TGG Intergenic
No off target data available for this crispr