ID: 1016176069

View in Genome Browser
Species Human (GRCh38)
Location 6:141078881-141078903
Sequence TTGGTGTTCCTGAGGAATAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016176064_1016176069 21 Left 1016176064 6:141078837-141078859 CCAAGAAGTTTGGAATTATGTTA 0: 10
1: 169
2: 564
3: 555
4: 1180
Right 1016176069 6:141078881-141078903 TTGGTGTTCCTGAGGAATAATGG No data
1016176063_1016176069 24 Left 1016176063 6:141078834-141078856 CCTCCAAGAAGTTTGGAATTATG 0: 10
1: 141
2: 529
3: 961
4: 7445
Right 1016176069 6:141078881-141078903 TTGGTGTTCCTGAGGAATAATGG No data
1016176066_1016176069 -7 Left 1016176066 6:141078865-141078887 CCAAACCTAAGAATAATTGGTGT 0: 265
1: 423
2: 482
3: 512
4: 1196
Right 1016176069 6:141078881-141078903 TTGGTGTTCCTGAGGAATAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016176069 Original CRISPR TTGGTGTTCCTGAGGAATAA TGG Intergenic
No off target data available for this crispr