ID: 1016181774

View in Genome Browser
Species Human (GRCh38)
Location 6:141155610-141155632
Sequence CTTTCGGAAGACTCCACCGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016181774_1016181782 21 Left 1016181774 6:141155610-141155632 CCAACGGTGGAGTCTTCCGAAAG No data
Right 1016181782 6:141155654-141155676 TATCGAAGAAAACCTAATGGTGG No data
1016181774_1016181781 18 Left 1016181774 6:141155610-141155632 CCAACGGTGGAGTCTTCCGAAAG No data
Right 1016181781 6:141155651-141155673 CCTTATCGAAGAAAACCTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016181774 Original CRISPR CTTTCGGAAGACTCCACCGT TGG (reversed) Intergenic
No off target data available for this crispr