ID: 1016181781

View in Genome Browser
Species Human (GRCh38)
Location 6:141155651-141155673
Sequence CCTTATCGAAGAAAACCTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016181774_1016181781 18 Left 1016181774 6:141155610-141155632 CCAACGGTGGAGTCTTCCGAAAG No data
Right 1016181781 6:141155651-141155673 CCTTATCGAAGAAAACCTAATGG No data
1016181773_1016181781 30 Left 1016181773 6:141155598-141155620 CCGTTGGTTATACCAACGGTGGA No data
Right 1016181781 6:141155651-141155673 CCTTATCGAAGAAAACCTAATGG No data
1016181778_1016181781 2 Left 1016181778 6:141155626-141155648 CCGAAAGGGCTGGTTTCTGATTA No data
Right 1016181781 6:141155651-141155673 CCTTATCGAAGAAAACCTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016181781 Original CRISPR CCTTATCGAAGAAAACCTAA TGG Intergenic