ID: 1016181782 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 6:141155654-141155676 |
Sequence | TATCGAAGAAAACCTAATGG TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1016181778_1016181782 | 5 | Left | 1016181778 | 6:141155626-141155648 | CCGAAAGGGCTGGTTTCTGATTA | No data | ||
Right | 1016181782 | 6:141155654-141155676 | TATCGAAGAAAACCTAATGGTGG | No data | ||||
1016181774_1016181782 | 21 | Left | 1016181774 | 6:141155610-141155632 | CCAACGGTGGAGTCTTCCGAAAG | No data | ||
Right | 1016181782 | 6:141155654-141155676 | TATCGAAGAAAACCTAATGGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1016181782 | Original CRISPR | TATCGAAGAAAACCTAATGG TGG | Intergenic | ||