ID: 1016183063

View in Genome Browser
Species Human (GRCh38)
Location 6:141170915-141170937
Sequence TATGAAATTCACTCTTGTCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016183063_1016183069 1 Left 1016183063 6:141170915-141170937 CCCCGACAAGAGTGAATTTCATA No data
Right 1016183069 6:141170939-141170961 CAGCCCTGTGGCAGTGTCTAGGG No data
1016183063_1016183068 0 Left 1016183063 6:141170915-141170937 CCCCGACAAGAGTGAATTTCATA No data
Right 1016183068 6:141170938-141170960 CCAGCCCTGTGGCAGTGTCTAGG No data
1016183063_1016183074 6 Left 1016183063 6:141170915-141170937 CCCCGACAAGAGTGAATTTCATA No data
Right 1016183074 6:141170944-141170966 CTGTGGCAGTGTCTAGGGGAGGG No data
1016183063_1016183073 5 Left 1016183063 6:141170915-141170937 CCCCGACAAGAGTGAATTTCATA No data
Right 1016183073 6:141170943-141170965 CCTGTGGCAGTGTCTAGGGGAGG No data
1016183063_1016183070 2 Left 1016183063 6:141170915-141170937 CCCCGACAAGAGTGAATTTCATA No data
Right 1016183070 6:141170940-141170962 AGCCCTGTGGCAGTGTCTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016183063 Original CRISPR TATGAAATTCACTCTTGTCG GGG (reversed) Intergenic
No off target data available for this crispr