ID: 1016183065

View in Genome Browser
Species Human (GRCh38)
Location 6:141170917-141170939
Sequence GGTATGAAATTCACTCTTGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016183065_1016183068 -2 Left 1016183065 6:141170917-141170939 CCGACAAGAGTGAATTTCATACC No data
Right 1016183068 6:141170938-141170960 CCAGCCCTGTGGCAGTGTCTAGG No data
1016183065_1016183069 -1 Left 1016183065 6:141170917-141170939 CCGACAAGAGTGAATTTCATACC No data
Right 1016183069 6:141170939-141170961 CAGCCCTGTGGCAGTGTCTAGGG No data
1016183065_1016183074 4 Left 1016183065 6:141170917-141170939 CCGACAAGAGTGAATTTCATACC No data
Right 1016183074 6:141170944-141170966 CTGTGGCAGTGTCTAGGGGAGGG No data
1016183065_1016183070 0 Left 1016183065 6:141170917-141170939 CCGACAAGAGTGAATTTCATACC No data
Right 1016183070 6:141170940-141170962 AGCCCTGTGGCAGTGTCTAGGGG No data
1016183065_1016183073 3 Left 1016183065 6:141170917-141170939 CCGACAAGAGTGAATTTCATACC No data
Right 1016183073 6:141170943-141170965 CCTGTGGCAGTGTCTAGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016183065 Original CRISPR GGTATGAAATTCACTCTTGT CGG (reversed) Intergenic
No off target data available for this crispr