ID: 1016183074

View in Genome Browser
Species Human (GRCh38)
Location 6:141170944-141170966
Sequence CTGTGGCAGTGTCTAGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016183063_1016183074 6 Left 1016183063 6:141170915-141170937 CCCCGACAAGAGTGAATTTCATA No data
Right 1016183074 6:141170944-141170966 CTGTGGCAGTGTCTAGGGGAGGG No data
1016183062_1016183074 26 Left 1016183062 6:141170895-141170917 CCAGGGTGAGCACTTTTGAGCCC No data
Right 1016183074 6:141170944-141170966 CTGTGGCAGTGTCTAGGGGAGGG No data
1016183064_1016183074 5 Left 1016183064 6:141170916-141170938 CCCGACAAGAGTGAATTTCATAC No data
Right 1016183074 6:141170944-141170966 CTGTGGCAGTGTCTAGGGGAGGG No data
1016183065_1016183074 4 Left 1016183065 6:141170917-141170939 CCGACAAGAGTGAATTTCATACC No data
Right 1016183074 6:141170944-141170966 CTGTGGCAGTGTCTAGGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016183074 Original CRISPR CTGTGGCAGTGTCTAGGGGA GGG Intergenic
No off target data available for this crispr