ID: 1016187666

View in Genome Browser
Species Human (GRCh38)
Location 6:141217954-141217976
Sequence ATTTCCTTCTAGTATAGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016187662_1016187666 -7 Left 1016187662 6:141217938-141217960 CCTTAAAAAGAACATTATTTCCT No data
Right 1016187666 6:141217954-141217976 ATTTCCTTCTAGTATAGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016187666 Original CRISPR ATTTCCTTCTAGTATAGGGA GGG Intergenic
No off target data available for this crispr