ID: 1016200786

View in Genome Browser
Species Human (GRCh38)
Location 6:141405169-141405191
Sequence CTAATTCAGCAGTTATCTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016200785_1016200786 18 Left 1016200785 6:141405128-141405150 CCAAAAATATGTGTTCTTATTAA No data
Right 1016200786 6:141405169-141405191 CTAATTCAGCAGTTATCTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016200786 Original CRISPR CTAATTCAGCAGTTATCTAA AGG Intergenic
No off target data available for this crispr