ID: 1016201587

View in Genome Browser
Species Human (GRCh38)
Location 6:141416914-141416936
Sequence CCCTACGTGCAGAGTGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016201584_1016201587 -7 Left 1016201584 6:141416898-141416920 CCTAGCACATGATCCTCCCTACG No data
Right 1016201587 6:141416914-141416936 CCCTACGTGCAGAGTGAAGCAGG No data
1016201583_1016201587 4 Left 1016201583 6:141416887-141416909 CCTTTGCTTGGCCTAGCACATGA No data
Right 1016201587 6:141416914-141416936 CCCTACGTGCAGAGTGAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016201587 Original CRISPR CCCTACGTGCAGAGTGAAGC AGG Intergenic
No off target data available for this crispr