ID: 1016205325

View in Genome Browser
Species Human (GRCh38)
Location 6:141460664-141460686
Sequence CACATGGAAGCGCATGAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016205319_1016205325 30 Left 1016205319 6:141460611-141460633 CCCAGGTGATTAAAAGCTTTATT 0: 240
1: 75
2: 45
3: 26
4: 311
Right 1016205325 6:141460664-141460686 CACATGGAAGCGCATGAAACTGG No data
1016205323_1016205325 -5 Left 1016205323 6:141460646-141460668 CCTGTTTGGTGGTCTCTTCACAT 0: 491
1: 1524
2: 619
3: 167
4: 166
Right 1016205325 6:141460664-141460686 CACATGGAAGCGCATGAAACTGG No data
1016205320_1016205325 29 Left 1016205320 6:141460612-141460634 CCAGGTGATTAAAAGCTTTATTG 0: 240
1: 81
2: 18
3: 42
4: 183
Right 1016205325 6:141460664-141460686 CACATGGAAGCGCATGAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016205325 Original CRISPR CACATGGAAGCGCATGAAAC TGG Intergenic
No off target data available for this crispr