ID: 1016205516

View in Genome Browser
Species Human (GRCh38)
Location 6:141463318-141463340
Sequence TTAATTCCAAACTCACAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016205513_1016205516 12 Left 1016205513 6:141463283-141463305 CCTTCTTTCTTGTGAGAAGAGCC No data
Right 1016205516 6:141463318-141463340 TTAATTCCAAACTCACAGCCTGG No data
1016205514_1016205516 -9 Left 1016205514 6:141463304-141463326 CCTCAACATATTCCTTAATTCCA No data
Right 1016205516 6:141463318-141463340 TTAATTCCAAACTCACAGCCTGG No data
1016205512_1016205516 28 Left 1016205512 6:141463267-141463289 CCGGCAACGGTTTCTGCCTTCTT No data
Right 1016205516 6:141463318-141463340 TTAATTCCAAACTCACAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016205516 Original CRISPR TTAATTCCAAACTCACAGCC TGG Intergenic
No off target data available for this crispr