ID: 1016205586

View in Genome Browser
Species Human (GRCh38)
Location 6:141464670-141464692
Sequence TAGTTTACACAACAAGATCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016205583_1016205586 1 Left 1016205583 6:141464646-141464668 CCACTTTCCATCACCTATTTTTA No data
Right 1016205586 6:141464670-141464692 TAGTTTACACAACAAGATCAAGG No data
1016205584_1016205586 -6 Left 1016205584 6:141464653-141464675 CCATCACCTATTTTTAATAGTTT No data
Right 1016205586 6:141464670-141464692 TAGTTTACACAACAAGATCAAGG No data
1016205582_1016205586 9 Left 1016205582 6:141464638-141464660 CCATGGTGCCACTTTCCATCACC No data
Right 1016205586 6:141464670-141464692 TAGTTTACACAACAAGATCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016205586 Original CRISPR TAGTTTACACAACAAGATCA AGG Intergenic
No off target data available for this crispr