ID: 1016205818 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:141467113-141467135 |
| Sequence | CAGGAGGCAGACAAATGTCT AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1016205818_1016205826 | 29 | Left | 1016205818 | 6:141467113-141467135 | CCTAGACATTTGTCTGCCTCCTG | No data | ||
| Right | 1016205826 | 6:141467165-141467187 | CATCTAACTTCCATTAGAATAGG | No data | ||||
| 1016205818_1016205827 | 30 | Left | 1016205818 | 6:141467113-141467135 | CCTAGACATTTGTCTGCCTCCTG | No data | ||
| Right | 1016205827 | 6:141467166-141467188 | ATCTAACTTCCATTAGAATAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1016205818 | Original CRISPR | CAGGAGGCAGACAAATGTCT AGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||