ID: 1016205819

View in Genome Browser
Species Human (GRCh38)
Location 6:141467129-141467151
Sequence GGGGAAATGATAGAGGCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016205819_1016205827 14 Left 1016205819 6:141467129-141467151 CCTCCTGCCTCTATCATTTCCCC No data
Right 1016205827 6:141467166-141467188 ATCTAACTTCCATTAGAATAGGG No data
1016205819_1016205826 13 Left 1016205819 6:141467129-141467151 CCTCCTGCCTCTATCATTTCCCC No data
Right 1016205826 6:141467165-141467187 CATCTAACTTCCATTAGAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016205819 Original CRISPR GGGGAAATGATAGAGGCAGG AGG (reversed) Intergenic
No off target data available for this crispr