ID: 1016205821

View in Genome Browser
Species Human (GRCh38)
Location 6:141467136-141467158
Sequence TTCAGAGGGGGAAATGATAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016205821_1016205827 7 Left 1016205821 6:141467136-141467158 CCTCTATCATTTCCCCCTCTGAA No data
Right 1016205827 6:141467166-141467188 ATCTAACTTCCATTAGAATAGGG No data
1016205821_1016205829 27 Left 1016205821 6:141467136-141467158 CCTCTATCATTTCCCCCTCTGAA No data
Right 1016205829 6:141467186-141467208 GGGACAAAGACCAGTCTTAATGG No data
1016205821_1016205826 6 Left 1016205821 6:141467136-141467158 CCTCTATCATTTCCCCCTCTGAA No data
Right 1016205826 6:141467165-141467187 CATCTAACTTCCATTAGAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016205821 Original CRISPR TTCAGAGGGGGAAATGATAG AGG (reversed) Intergenic
No off target data available for this crispr