ID: 1016205825

View in Genome Browser
Species Human (GRCh38)
Location 6:141467151-141467173
Sequence AGTTAGATGTACTTCTTCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016205825_1016205826 -9 Left 1016205825 6:141467151-141467173 CCTCTGAAGAAGTACATCTAACT No data
Right 1016205826 6:141467165-141467187 CATCTAACTTCCATTAGAATAGG No data
1016205825_1016205827 -8 Left 1016205825 6:141467151-141467173 CCTCTGAAGAAGTACATCTAACT No data
Right 1016205827 6:141467166-141467188 ATCTAACTTCCATTAGAATAGGG No data
1016205825_1016205832 28 Left 1016205825 6:141467151-141467173 CCTCTGAAGAAGTACATCTAACT No data
Right 1016205832 6:141467202-141467224 TTAATGGCTTCCTGTTGACAGGG No data
1016205825_1016205831 27 Left 1016205825 6:141467151-141467173 CCTCTGAAGAAGTACATCTAACT No data
Right 1016205831 6:141467201-141467223 CTTAATGGCTTCCTGTTGACAGG No data
1016205825_1016205833 29 Left 1016205825 6:141467151-141467173 CCTCTGAAGAAGTACATCTAACT No data
Right 1016205833 6:141467203-141467225 TAATGGCTTCCTGTTGACAGGGG No data
1016205825_1016205829 12 Left 1016205825 6:141467151-141467173 CCTCTGAAGAAGTACATCTAACT No data
Right 1016205829 6:141467186-141467208 GGGACAAAGACCAGTCTTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016205825 Original CRISPR AGTTAGATGTACTTCTTCAG AGG (reversed) Intergenic
No off target data available for this crispr