ID: 1016205826

View in Genome Browser
Species Human (GRCh38)
Location 6:141467165-141467187
Sequence CATCTAACTTCCATTAGAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016205823_1016205826 -7 Left 1016205823 6:141467149-141467171 CCCCTCTGAAGAAGTACATCTAA No data
Right 1016205826 6:141467165-141467187 CATCTAACTTCCATTAGAATAGG No data
1016205820_1016205826 10 Left 1016205820 6:141467132-141467154 CCTGCCTCTATCATTTCCCCCTC No data
Right 1016205826 6:141467165-141467187 CATCTAACTTCCATTAGAATAGG No data
1016205821_1016205826 6 Left 1016205821 6:141467136-141467158 CCTCTATCATTTCCCCCTCTGAA No data
Right 1016205826 6:141467165-141467187 CATCTAACTTCCATTAGAATAGG No data
1016205822_1016205826 -6 Left 1016205822 6:141467148-141467170 CCCCCTCTGAAGAAGTACATCTA No data
Right 1016205826 6:141467165-141467187 CATCTAACTTCCATTAGAATAGG No data
1016205819_1016205826 13 Left 1016205819 6:141467129-141467151 CCTCCTGCCTCTATCATTTCCCC No data
Right 1016205826 6:141467165-141467187 CATCTAACTTCCATTAGAATAGG No data
1016205818_1016205826 29 Left 1016205818 6:141467113-141467135 CCTAGACATTTGTCTGCCTCCTG No data
Right 1016205826 6:141467165-141467187 CATCTAACTTCCATTAGAATAGG No data
1016205824_1016205826 -8 Left 1016205824 6:141467150-141467172 CCCTCTGAAGAAGTACATCTAAC No data
Right 1016205826 6:141467165-141467187 CATCTAACTTCCATTAGAATAGG No data
1016205825_1016205826 -9 Left 1016205825 6:141467151-141467173 CCTCTGAAGAAGTACATCTAACT No data
Right 1016205826 6:141467165-141467187 CATCTAACTTCCATTAGAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016205826 Original CRISPR CATCTAACTTCCATTAGAAT AGG Intergenic
No off target data available for this crispr