ID: 1016205828

View in Genome Browser
Species Human (GRCh38)
Location 6:141467175-141467197
Sequence GGTCTTTGTCCCTATTCTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016205828_1016205832 4 Left 1016205828 6:141467175-141467197 CCATTAGAATAGGGACAAAGACC No data
Right 1016205832 6:141467202-141467224 TTAATGGCTTCCTGTTGACAGGG No data
1016205828_1016205833 5 Left 1016205828 6:141467175-141467197 CCATTAGAATAGGGACAAAGACC No data
Right 1016205833 6:141467203-141467225 TAATGGCTTCCTGTTGACAGGGG No data
1016205828_1016205831 3 Left 1016205828 6:141467175-141467197 CCATTAGAATAGGGACAAAGACC No data
Right 1016205831 6:141467201-141467223 CTTAATGGCTTCCTGTTGACAGG No data
1016205828_1016205835 17 Left 1016205828 6:141467175-141467197 CCATTAGAATAGGGACAAAGACC No data
Right 1016205835 6:141467215-141467237 GTTGACAGGGGTCACTGTTTTGG No data
1016205828_1016205836 18 Left 1016205828 6:141467175-141467197 CCATTAGAATAGGGACAAAGACC No data
Right 1016205836 6:141467216-141467238 TTGACAGGGGTCACTGTTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016205828 Original CRISPR GGTCTTTGTCCCTATTCTAA TGG (reversed) Intergenic
No off target data available for this crispr