ID: 1016205831

View in Genome Browser
Species Human (GRCh38)
Location 6:141467201-141467223
Sequence CTTAATGGCTTCCTGTTGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016205825_1016205831 27 Left 1016205825 6:141467151-141467173 CCTCTGAAGAAGTACATCTAACT No data
Right 1016205831 6:141467201-141467223 CTTAATGGCTTCCTGTTGACAGG No data
1016205824_1016205831 28 Left 1016205824 6:141467150-141467172 CCCTCTGAAGAAGTACATCTAAC No data
Right 1016205831 6:141467201-141467223 CTTAATGGCTTCCTGTTGACAGG No data
1016205822_1016205831 30 Left 1016205822 6:141467148-141467170 CCCCCTCTGAAGAAGTACATCTA No data
Right 1016205831 6:141467201-141467223 CTTAATGGCTTCCTGTTGACAGG No data
1016205828_1016205831 3 Left 1016205828 6:141467175-141467197 CCATTAGAATAGGGACAAAGACC No data
Right 1016205831 6:141467201-141467223 CTTAATGGCTTCCTGTTGACAGG No data
1016205823_1016205831 29 Left 1016205823 6:141467149-141467171 CCCCTCTGAAGAAGTACATCTAA No data
Right 1016205831 6:141467201-141467223 CTTAATGGCTTCCTGTTGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016205831 Original CRISPR CTTAATGGCTTCCTGTTGAC AGG Intergenic
No off target data available for this crispr