ID: 1016205833

View in Genome Browser
Species Human (GRCh38)
Location 6:141467203-141467225
Sequence TAATGGCTTCCTGTTGACAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016205828_1016205833 5 Left 1016205828 6:141467175-141467197 CCATTAGAATAGGGACAAAGACC No data
Right 1016205833 6:141467203-141467225 TAATGGCTTCCTGTTGACAGGGG No data
1016205825_1016205833 29 Left 1016205825 6:141467151-141467173 CCTCTGAAGAAGTACATCTAACT No data
Right 1016205833 6:141467203-141467225 TAATGGCTTCCTGTTGACAGGGG No data
1016205824_1016205833 30 Left 1016205824 6:141467150-141467172 CCCTCTGAAGAAGTACATCTAAC No data
Right 1016205833 6:141467203-141467225 TAATGGCTTCCTGTTGACAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016205833 Original CRISPR TAATGGCTTCCTGTTGACAG GGG Intergenic
No off target data available for this crispr