ID: 1016209431

View in Genome Browser
Species Human (GRCh38)
Location 6:141510394-141510416
Sequence CTGGAGAAGCTGAAGCAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016209431_1016209441 25 Left 1016209431 6:141510394-141510416 CCCTCCTGCTTCAGCTTCTCCAG No data
Right 1016209441 6:141510442-141510464 ATGTGCAGCTCCATGGGAATAGG No data
1016209431_1016209435 -6 Left 1016209431 6:141510394-141510416 CCCTCCTGCTTCAGCTTCTCCAG No data
Right 1016209435 6:141510411-141510433 CTCCAGGTCCTGTACACATGTGG No data
1016209431_1016209437 -1 Left 1016209431 6:141510394-141510416 CCCTCCTGCTTCAGCTTCTCCAG No data
Right 1016209437 6:141510416-141510438 GGTCCTGTACACATGTGGTTAGG No data
1016209431_1016209439 18 Left 1016209431 6:141510394-141510416 CCCTCCTGCTTCAGCTTCTCCAG No data
Right 1016209439 6:141510435-141510457 TAGGCACATGTGCAGCTCCATGG No data
1016209431_1016209440 19 Left 1016209431 6:141510394-141510416 CCCTCCTGCTTCAGCTTCTCCAG No data
Right 1016209440 6:141510436-141510458 AGGCACATGTGCAGCTCCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016209431 Original CRISPR CTGGAGAAGCTGAAGCAGGA GGG (reversed) Intergenic
No off target data available for this crispr