ID: 1016210404

View in Genome Browser
Species Human (GRCh38)
Location 6:141525793-141525815
Sequence GAGATTTATTCCATCTATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016210402_1016210404 16 Left 1016210402 6:141525754-141525776 CCATTCATATATAAAATGAATTA No data
Right 1016210404 6:141525793-141525815 GAGATTTATTCCATCTATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016210404 Original CRISPR GAGATTTATTCCATCTATGC AGG Intergenic
No off target data available for this crispr