ID: 1016211753

View in Genome Browser
Species Human (GRCh38)
Location 6:141544458-141544480
Sequence TGGGGAAAACAGGAGGGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016211741_1016211753 27 Left 1016211741 6:141544408-141544430 CCAAATAATTCCAAAGATTGGTG No data
Right 1016211753 6:141544458-141544480 TGGGGAAAACAGGAGGGGCAGGG No data
1016211742_1016211753 17 Left 1016211742 6:141544418-141544440 CCAAAGATTGGTGTGTAATTTGT No data
Right 1016211753 6:141544458-141544480 TGGGGAAAACAGGAGGGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016211753 Original CRISPR TGGGGAAAACAGGAGGGGCA GGG Intergenic
No off target data available for this crispr