ID: 1016212951

View in Genome Browser
Species Human (GRCh38)
Location 6:141562394-141562416
Sequence TACCCAATGCTGCCTGTTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016212951_1016212954 6 Left 1016212951 6:141562394-141562416 CCTCTAACAGGCAGCATTGGGTA No data
Right 1016212954 6:141562423-141562445 CGGTTTCAACTTTCACCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016212951 Original CRISPR TACCCAATGCTGCCTGTTAG AGG (reversed) Intergenic
No off target data available for this crispr