ID: 1016216686

View in Genome Browser
Species Human (GRCh38)
Location 6:141612718-141612740
Sequence AGTGCCCAGTGTATGTTCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016216684_1016216686 -7 Left 1016216684 6:141612702-141612724 CCCAGAGAATATTCAGAGTGCCC No data
Right 1016216686 6:141612718-141612740 AGTGCCCAGTGTATGTTCTGAGG No data
1016216685_1016216686 -8 Left 1016216685 6:141612703-141612725 CCAGAGAATATTCAGAGTGCCCA No data
Right 1016216686 6:141612718-141612740 AGTGCCCAGTGTATGTTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016216686 Original CRISPR AGTGCCCAGTGTATGTTCTG AGG Intergenic
No off target data available for this crispr