ID: 1016224182

View in Genome Browser
Species Human (GRCh38)
Location 6:141714477-141714499
Sequence GAACTGTCCTAGGCCAAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016224182_1016224184 14 Left 1016224182 6:141714477-141714499 CCTGTTTTGGCCTAGGACAGTTC No data
Right 1016224184 6:141714514-141714536 ACAGCGTCTGTTTTGAGTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016224182 Original CRISPR GAACTGTCCTAGGCCAAAAC AGG (reversed) Intergenic
No off target data available for this crispr