ID: 1016225665

View in Genome Browser
Species Human (GRCh38)
Location 6:141733275-141733297
Sequence GGAGGTTTATCTAGACTCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016225665_1016225669 7 Left 1016225665 6:141733275-141733297 CCATAGAGTCTAGATAAACCTCC No data
Right 1016225669 6:141733305-141733327 TGAACTTGTAAAATACAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016225665 Original CRISPR GGAGGTTTATCTAGACTCTA TGG (reversed) Intergenic