ID: 1016225665 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 6:141733275-141733297 |
Sequence | GGAGGTTTATCTAGACTCTA TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1016225665_1016225669 | 7 | Left | 1016225665 | 6:141733275-141733297 | CCATAGAGTCTAGATAAACCTCC | No data | ||
Right | 1016225669 | 6:141733305-141733327 | TGAACTTGTAAAATACAAGCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1016225665 | Original CRISPR | GGAGGTTTATCTAGACTCTA TGG (reversed) | Intergenic | ||