ID: 1016229684

View in Genome Browser
Species Human (GRCh38)
Location 6:141788279-141788301
Sequence AGGGAGAGCATAGTAATTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016229677_1016229684 24 Left 1016229677 6:141788232-141788254 CCAGCAGAAGACACTGGGCAAAA No data
Right 1016229684 6:141788279-141788301 AGGGAGAGCATAGTAATTGTGGG No data
1016229676_1016229684 25 Left 1016229676 6:141788231-141788253 CCCAGCAGAAGACACTGGGCAAA No data
Right 1016229684 6:141788279-141788301 AGGGAGAGCATAGTAATTGTGGG No data
1016229675_1016229684 26 Left 1016229675 6:141788230-141788252 CCCCAGCAGAAGACACTGGGCAA No data
Right 1016229684 6:141788279-141788301 AGGGAGAGCATAGTAATTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016229684 Original CRISPR AGGGAGAGCATAGTAATTGT GGG Intergenic
No off target data available for this crispr