ID: 1016234304

View in Genome Browser
Species Human (GRCh38)
Location 6:141844206-141844228
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1433
Summary {0: 2, 1: 6, 2: 118, 3: 319, 4: 988}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016234304_1016234309 10 Left 1016234304 6:141844206-141844228 CCTAGACCAATGCCCTGAAACAT 0: 2
1: 6
2: 118
3: 319
4: 988
Right 1016234309 6:141844239-141844261 TTTTCCAGTAGAAACATATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016234304 Original CRISPR ATGTTTCAGGGCATTGGTCT AGG (reversed) Intergenic
901189136 1:7394767-7394789 ATGCTTCATGATATTGGTCTGGG - Intronic
901262325 1:7882483-7882505 ATGCTTCAGGACATCAGTCTTGG + Intergenic
901271991 1:7959206-7959228 ATGTTCCAGGGTATTGATCTGGG + Intronic
902107928 1:14053084-14053106 ATGTTACATGGCAGTGGTCACGG + Intergenic
902510803 1:16966012-16966034 GCGATTCAGGGCACTGGTCTGGG - Exonic
902964653 1:19990970-19990992 AAGTGTCAGGGGTTTGGTCTAGG - Intergenic
905166326 1:36085266-36085288 CTGTGTCAGGGCATCGATCTCGG - Exonic
905353812 1:37366849-37366871 ATTTTGCAAGGCATTGGTCAAGG - Intergenic
905757758 1:40525726-40525748 ATGTTTCAGACTATTGGTCTAGG + Intergenic
906583978 1:46959772-46959794 ATGCTTCAGGACATTGGTCTGGG + Intergenic
906812157 1:48838605-48838627 ATGCTTTAGGACATTGGTCTAGG + Intronic
907607977 1:55838730-55838752 ATGCTTCATGACATTGGTCTGGG - Intergenic
907696304 1:56732901-56732923 ACACTTCAGGACATTGGTCTAGG + Intronic
907877885 1:58511838-58511860 AAGTTTCATGACTTTGGTCTTGG + Intronic
908578634 1:65489687-65489709 ATTCTCCAGGACATTGGTCTTGG - Intronic
908580268 1:65508260-65508282 AAGTTTCACGACATTGGTCTGGG - Intronic
908604776 1:65784836-65784858 ATGCTGCAGGACATTGGTCTGGG + Intergenic
908616497 1:65928652-65928674 ATTTTGCAAGGCATTGGTCAAGG + Intronic
908907378 1:69031459-69031481 ACACTTCAGGACATTGGTCTAGG + Intergenic
909183727 1:72458275-72458297 ATGCTTTAGGACATTGGTCTGGG - Intergenic
909208892 1:72797005-72797027 ATTCTTCAGGACATTGGTCTAGG - Intergenic
909574018 1:77152418-77152440 ATGTTCCAGGACATTATTCTGGG + Intronic
910100746 1:83573527-83573549 ATGTTTGATAGAATTGGTCTAGG - Intergenic
910104852 1:83620824-83620846 ACACTTCAGGACATTGGTCTAGG + Intergenic
910193211 1:84615165-84615187 ATGCTTCATGACATTGGTCTGGG + Intergenic
910378808 1:86602982-86603004 ATTCTCCAGGACATTGGTCTGGG - Intergenic
910904059 1:92154847-92154869 AAGCTTCATGACATTGGTCTTGG - Intergenic
911172902 1:94788766-94788788 ATGCTTCAGGATATTGGTCTGGG + Intergenic
911219156 1:95228894-95228916 ATGGATCAGGACATTGGTCTAGG + Intronic
911239023 1:95444857-95444879 ATGCTTCAGGACGTTGGTCTGGG - Intergenic
911313301 1:96324360-96324382 AAGTTCCATGACATTGGTCTAGG + Intergenic
911362121 1:96890380-96890402 ATGCTTCAAGACATTGATCTGGG - Intergenic
911615006 1:100000779-100000801 ATGTTTCAGGACATTGGTCAGGG - Intronic
911752640 1:101515162-101515184 ATGCTCCAGGACATTGTTCTGGG - Intergenic
911828163 1:102514421-102514443 ATGCTTCATGACATTGGACTGGG + Intergenic
911883319 1:103268542-103268564 ATTTTGCAAGGCATTGGTCAAGG - Intergenic
911925497 1:103825566-103825588 ACACTTCAGGGCTTTGGTCTAGG + Intergenic
911982638 1:104585824-104585846 ATGCTTTAGCACATTGGTCTGGG - Intergenic
911992966 1:104725983-104726005 AAGCTTCATGTCATTGGTCTTGG + Intergenic
912005739 1:104898301-104898323 ACATTTCAGAACATTGGTCTTGG - Intergenic
912016928 1:105050373-105050395 ATGCTTCCTGACATTGGTCTGGG + Intergenic
912066792 1:105755014-105755036 ATTTTACAAGGCATTGGTCAAGG - Intergenic
912148332 1:106822504-106822526 ATAGTTCAGAACATTGGTCTGGG - Intergenic
912314419 1:108653963-108653985 ATGCTTCAGGACATTGGTCTAGG - Intronic
912608399 1:111017107-111017129 ACACTTCAGGACATTGGTCTGGG - Intergenic
912610612 1:111039344-111039366 TTGCTTCATGACATTGGTCTGGG + Intergenic
912616519 1:111106056-111106078 ATGTTTCAGAACATTTGTCTGGG - Intergenic
912639071 1:111327159-111327181 ACACTTCAGGACATTGGTCTAGG - Intergenic
912733579 1:112130762-112130784 ATTTCTCAAGGCATTGGTCAAGG + Intergenic
912771572 1:112468877-112468899 ACTCTTCAGGGCATTGGTCTAGG - Intronic
912909230 1:113740635-113740657 ATGCTTAAGAACATTGGTCTGGG - Intronic
912912959 1:113781335-113781357 TTGTTTCAGGGGAGTGGTATGGG - Intronic
913176847 1:116281295-116281317 GTGTTTCAGGTTATTGGTCTGGG - Intergenic
913378245 1:118179509-118179531 ATGTTTCAGGACATTGGTCTAGG + Intronic
913424753 1:118715202-118715224 ATGATCCATGACATTGGTCTGGG + Intergenic
913471091 1:119187515-119187537 ATGCTTTAGGACATTGGTGTAGG - Intergenic
913667454 1:121061288-121061310 ATGTTTAAGGGCCTTGGTTGTGG - Intergenic
914019146 1:143848431-143848453 ATGTTTAAGGGCCTTGGTTGTGG - Intergenic
914657696 1:149756638-149756660 ATGTTTAAGGGCCTTGGTTGTGG - Intergenic
914703618 1:150154274-150154296 GTGTTTCTGGGAATTGCTCTTGG + Intronic
914966096 1:152258863-152258885 ACCTTTCAGGACATTGATCTAGG - Intergenic
914977989 1:152383974-152383996 ATATGTCAGGACATTAGTCTAGG - Intergenic
915688444 1:157661555-157661577 ATGCTCCAGGACATTGGTCTAGG - Intergenic
915800697 1:158789909-158789931 ATACTTCAGGGCATTGGCCTGGG - Intergenic
916218958 1:162423898-162423920 ATGTTCCATGACATTGGTCTGGG + Intergenic
916323100 1:163527644-163527666 ATGCTTCAGGACATCAGTCTAGG + Intergenic
916794840 1:168156409-168156431 ACACTTCAGGACATTGGTCTGGG - Intergenic
916883086 1:169041096-169041118 ACATTCCAGGACATTGGTCTGGG + Intergenic
917351189 1:174079688-174079710 ATACTCCAGGTCATTGGTCTGGG + Intergenic
917383671 1:174443753-174443775 ATGCTTCAGGACATTGGTTTTGG - Intronic
917607439 1:176647485-176647507 ATTTTTCATGGCATTGGACTGGG - Intronic
917709116 1:177666403-177666425 CTGTTTCAGGGCCCTGATCTGGG + Intergenic
917863026 1:179166162-179166184 ATGCTTCAGGACATTGATCTAGG + Intronic
918020173 1:180679810-180679832 ATGCTTTAGGACATTGGTCTGGG + Intronic
918228982 1:182511007-182511029 ATGCTCCAGGACATTGGTCTGGG - Intronic
918364542 1:183793339-183793361 ATGCTTTAGGACATTAGTCTGGG + Intronic
918797805 1:188926866-188926888 ATGCTCCAGGGCCTTGATCTTGG - Intergenic
918853914 1:189726339-189726361 ATTTTCCAGGACATTGGTCTGGG - Intergenic
918941522 1:191004806-191004828 AATTTCCAGGACATTGGTCTGGG - Intergenic
919013099 1:191990985-191991007 AATTTCCAGGGCATTGGTCTGGG + Intergenic
919034312 1:192286144-192286166 ATGCTTCATGGCATTGGTCTAGG + Intergenic
919157228 1:193781671-193781693 ATGTTTCAGGACACCAGTCTGGG + Intergenic
919172698 1:193975452-193975474 ATGCTTCAGCACATTGGTCTGGG - Intergenic
919287997 1:195590019-195590041 AATCTTCAGGACATTGGTCTGGG + Intergenic
919320909 1:196036943-196036965 ATGCTTCAAGACATTGGTCTAGG - Intergenic
920183423 1:204146537-204146559 AGGTTTAAGGGCTTAGGTCTCGG - Intronic
920384508 1:205560139-205560161 ATGCTTCAGGACATTGGTCCAGG + Intergenic
920602388 1:207341339-207341361 ATGCTACAGGACATTAGTCTAGG - Intronic
920778362 1:208963478-208963500 ATGCTTCAGGAAATGGGTCTAGG - Intergenic
920990493 1:210934103-210934125 ATGCTTCAGGACATTAGTCTGGG + Intronic
921461808 1:215436325-215436347 ATGCTTAAGGACATTGGTCTAGG - Intergenic
921529610 1:216264984-216265006 GTGCTTCAGGACATTGGTCTGGG + Intronic
921586760 1:216956114-216956136 ACTCTTCAGGACATTGGTCTAGG - Intronic
921617403 1:217285860-217285882 ATGCTTCAGGACATTAGTCTGGG - Intergenic
921956391 1:220988351-220988373 ATACTTCAGGCCATTGGTCTGGG - Intergenic
922094250 1:222428839-222428861 ATTCTTCTGGACATTGGTCTAGG + Intergenic
922403951 1:225292173-225292195 ATGCTTCAGGACATTGGTCTTGG - Intronic
922512177 1:226178216-226178238 ATCTTTCAGAGCTTTGGACTTGG - Intronic
922780261 1:228246795-228246817 ATGTTTCAGGTCAGTGCTTTGGG + Exonic
923173210 1:231436449-231436471 ATGCTTCAGGACAACGGTCTGGG + Intergenic
923350721 1:233102938-233102960 ATGCTTCAGGACCTTGGACTGGG - Intronic
924068288 1:240249171-240249193 ATACTTCAGGAAATTGGTCTAGG - Intronic
924488130 1:244507558-244507580 ATGCTTTAGGACGTTGGTCTGGG - Intronic
924574915 1:245270830-245270852 AAGTTTCAAAACATTGGTCTTGG - Intronic
924662011 1:246029131-246029153 ACACTTCAGGACATTGGTCTAGG + Intronic
924792331 1:247263478-247263500 AACTTGCAGGACATTGGTCTGGG - Intergenic
924893461 1:248309695-248309717 ATGCTCCAGGACATTGGACTAGG - Intergenic
1063305770 10:4898660-4898682 AATCTTCAGGACATTGGTCTGGG - Intergenic
1063768006 10:9164638-9164660 ATGCTTCATGACATAGGTCTGGG - Intergenic
1063945073 10:11168028-11168050 GTGTTTCAGGGCCTGGGTCAGGG + Intronic
1064305312 10:14160357-14160379 ACAATTCAGGACATTGGTCTCGG + Intronic
1064887700 10:20129585-20129607 ATGTTTCCTGACATTGATCTGGG - Intronic
1065041286 10:21699448-21699470 ACACTTCAGGACATTGGTCTAGG - Intronic
1065056463 10:21848515-21848537 ATACTTCAGGACATTGGTCTGGG - Intronic
1065566724 10:27018905-27018927 TTGCTTCAGGACATTGGTCTAGG + Intronic
1066079321 10:31914239-31914261 ATGCTTCATGACATTAGTCTGGG - Intronic
1066173225 10:32874866-32874888 ATTCTTCTGGGCATTGGCCTAGG - Intronic
1066336850 10:34486408-34486430 TTGTTTCAGGGCAATGGTGGTGG + Intronic
1066368835 10:34802554-34802576 ATGTGTCAAAGCTTTGGTCTGGG + Intronic
1066651598 10:37661293-37661315 ATGGTGCAGAGCCTTGGTCTTGG - Intergenic
1066685120 10:37974194-37974216 ATGCTTCAGAACATTGTTCTCGG + Intronic
1066688628 10:38004916-38004938 ACTCTTCAGGGCATTGGTCTAGG + Intergenic
1066762799 10:38772071-38772093 ATGCTCCAGGACATTAGTCTGGG - Intergenic
1066763352 10:38779526-38779548 ATCCTTCAGGACATTGCTCTGGG + Intergenic
1067004016 10:42644081-42644103 ACTCTTCAGGGCATTGGCCTAGG - Intergenic
1067035380 10:42911723-42911745 ATGGTGCAGAGCCTTGGTCTTGG - Intergenic
1067168402 10:43883674-43883696 GTTTTTAAGGGCATTGTTCTGGG - Intergenic
1067191534 10:44072928-44072950 ACGTTTCATGACATTGGTCCTGG - Intergenic
1067285003 10:44901519-44901541 GTTTTTCAGGGCATTGTCCTAGG - Intergenic
1067522426 10:47017701-47017723 ATGCTTCAGGACATTGGTATGGG + Intergenic
1067959383 10:50831177-50831199 AAGTTTCTTGACATTGGTCTGGG + Intronic
1068054569 10:51995882-51995904 AAGCTCCAGGACATTGGTCTGGG + Intronic
1068239357 10:54285166-54285188 ATACTTCATGACATTGGTCTAGG + Intronic
1068457463 10:57275589-57275611 ATGCTTCAGGATATTTGTCTGGG + Intergenic
1068478518 10:57559831-57559853 AATCTTCAGGACATTGGTCTGGG - Intergenic
1068837501 10:61570537-61570559 ATTTTGCAAGGCATTGGTCAAGG + Intergenic
1068838654 10:61585339-61585361 ATTCTTCAGGACATTGGCCTAGG + Intergenic
1069371707 10:67754605-67754627 ATGCTCCAGGACATTGGTCTGGG + Intergenic
1070317393 10:75328170-75328192 ATGCTTCCAGACATTGGTCTGGG - Intergenic
1071016060 10:80998246-80998268 CTGTTTCAGGGTATGGTTCTTGG + Intergenic
1071209552 10:83323156-83323178 ATTTTCCAGGACATTGGTCTGGG + Intergenic
1071221275 10:83467837-83467859 ACTCTTCAGGACATTGGTCTGGG + Intergenic
1071301562 10:84260011-84260033 ACTCTTCTGGGCATTGGTCTAGG - Intergenic
1071667264 10:87571632-87571654 ACATTTCAGGACATTGGTCTAGG + Intergenic
1071910637 10:90228951-90228973 ATGCTTGATGACATTGGTCTGGG - Intergenic
1072078107 10:91999332-91999354 ATTTTTCAGGTCATTAGGCTGGG - Intronic
1072347962 10:94527635-94527657 ATGCTTCAGGACATTAGTCTTGG - Intronic
1072375178 10:94807947-94807969 ATGCTTCAGAGTATTGGTCTTGG - Intronic
1073354313 10:102841664-102841686 AGGTTTCCAGGTATTGGTCTGGG + Intergenic
1073437066 10:103524517-103524539 ATGCTTCAGGACATTGGTCTGGG - Intronic
1074017985 10:109554280-109554302 AAGTTTCAGGACATTGCTCTGGG - Intergenic
1074127118 10:110537469-110537491 GTGTTCCAAGACATTGGTCTGGG + Intergenic
1074642924 10:115408641-115408663 ATGCTTCAGGACATGGATCTGGG - Intronic
1074693141 10:116025253-116025275 ATGATGCTGGGCACTGGTCTGGG + Intergenic
1075629073 10:123989492-123989514 ATGTTTTAGGACATAGGCCTGGG - Intergenic
1076920356 10:133449526-133449548 ATGAGTCAGGACATTGGTTTGGG + Intergenic
1077687772 11:4313628-4313650 AAGCTTCATGACATTGGTCTGGG + Intergenic
1077692934 11:4364812-4364834 AAGCTTCATGACATTGGTCTGGG + Intergenic
1077959158 11:7054876-7054898 ATGCTCCAGGACATTGGACTGGG - Intronic
1078124611 11:8548182-8548204 ATACTTGAGGACATTGGTCTGGG - Intronic
1078277748 11:9866646-9866668 ATGCTGCAGGACATTGGTCTGGG + Intronic
1078494727 11:11804969-11804991 ATGCTTCTGGACATTGGCCTAGG + Intergenic
1078584611 11:12571890-12571912 ACTTTTCAGGACATTGATCTGGG + Intergenic
1078606011 11:12776150-12776172 AGGTTTTAGGACATTGGTCCGGG + Intronic
1079271893 11:18995085-18995107 AATTTCCAGGACATTGGTCTGGG - Intergenic
1079434613 11:20435116-20435138 ACGCTTCAGGACATTAGTCTGGG - Intronic
1079529606 11:21434264-21434286 ATGCTTCAGAACATTGGTCTTGG - Intronic
1079557075 11:21772854-21772876 ATGTTTCAGGACATTTGTCTAGG - Intergenic
1079651041 11:22930423-22930445 ATGTTACAGGACATTGCTCTGGG - Intergenic
1080788989 11:35502915-35502937 ATGCTCCAGGACATTGATCTGGG - Intronic
1080848912 11:36050844-36050866 ATCTGTCAGTGCCTTGGTCTTGG - Intronic
1080970652 11:37271643-37271665 ATTCTTCTGGACATTGGTCTAGG + Intergenic
1080983789 11:37437359-37437381 ATGTTTTAGGGCATTCTCCTTGG + Intergenic
1080998018 11:37628654-37628676 ATGTTTCAGGATATTGGTCTGGG - Intergenic
1081045021 11:38262864-38262886 ACATTCCAGGACATTGGTCTGGG - Intergenic
1081073262 11:38636338-38636360 ATTTTCCAGGACATTGGACTGGG - Intergenic
1081143077 11:39527968-39527990 ATGTTTCATGAGATTGGTCTTGG - Intergenic
1081212212 11:40350164-40350186 ATGCTTCAGGACATTGGTCTGGG - Intronic
1081310968 11:41571752-41571774 ACTTTTCAGGACATTGGTTTAGG - Intergenic
1081324864 11:41731742-41731764 ACACTTCAGGACATTGGTCTAGG - Intergenic
1081683538 11:45025748-45025770 ATGGTTCAGGGGATGGGTCTAGG + Intergenic
1081985387 11:47298750-47298772 ATGCTTCAGGACATTGGTCTGGG - Intronic
1082901040 11:58252523-58252545 ATTCCTCAGGACATTGGTCTGGG - Intergenic
1082908536 11:58341938-58341960 ATCATTCTGGGCATTGGCCTTGG + Intergenic
1083041933 11:59696976-59696998 AAGCTTCATGGCATTGGTCTTGG - Intergenic
1083071612 11:59989890-59989912 AATCTCCAGGGCATTGGTCTGGG - Intergenic
1083210226 11:61179776-61179798 ATGCTTCAGGACATTGGTCTGGG - Intergenic
1083530057 11:63412326-63412348 ACATTTCTGGACATTGGTCTGGG + Intergenic
1084763340 11:71288842-71288864 ATGCTCCAGGACATTGGACTGGG - Intergenic
1084986770 11:72880950-72880972 ATGCTTCTGGACATTGGTCAAGG + Intronic
1085142379 11:74158102-74158124 ATGCTTCATGACATTGGTCCAGG + Intronic
1085252902 11:75155253-75155275 ATGTCTCCAGGCATTGGGCTTGG - Intronic
1085664650 11:78403076-78403098 ATGTGTCAGTGCCTTGATCTTGG + Intronic
1085664688 11:78403655-78403677 ATGCTCCAGGACATTGGTCTGGG + Intronic
1085990922 11:81843268-81843290 ATGATGCAGGACATCGGTCTCGG - Intergenic
1086123198 11:83322263-83322285 ACACTTCAGGACATTGGTCTAGG - Intergenic
1086470484 11:87104006-87104028 AAGCTTCATGGCACTGGTCTAGG - Intronic
1086720011 11:90108343-90108365 ATGCTCCAGGACATTGGTCCGGG - Intergenic
1086720529 11:90115743-90115765 ATCCTTCAGGACATTGCTCTGGG + Intergenic
1087133465 11:94690816-94690838 ATGCTCCACGACATTGGTCTGGG + Intergenic
1087154651 11:94889098-94889120 ATGTGTCACGGCATTTATCTAGG - Intergenic
1087350488 11:97025629-97025651 ACTTTCCAGGACATTGGTCTGGG + Intergenic
1087401956 11:97678641-97678663 ATTTTCCAGGACATTGGTCTGGG - Intergenic
1087445498 11:98246388-98246410 GTGCTTCAGGACATTGGTTTGGG - Intergenic
1087465882 11:98504679-98504701 ATGCTTCATGGAATTGGACTGGG - Intergenic
1087489596 11:98807683-98807705 ATACTTCTGGACATTGGTCTAGG - Intergenic
1087503379 11:98988952-98988974 ATGTTCCAGGACGTTGGTCCAGG - Intergenic
1087675840 11:101160197-101160219 ATACTCCAGGACATTGGTCTAGG - Intergenic
1087679748 11:101206577-101206599 ATGCTTCAGGACATTTGTCCGGG - Intergenic
1087864953 11:103213901-103213923 ATGCTCCAGGACATTGGTTTAGG - Intronic
1087888857 11:103513376-103513398 ATGCTTCAGAACATTGGTCTGGG + Intergenic
1088323518 11:108578108-108578130 ATGCTCCAGGACATTGGTCTGGG - Intronic
1088323669 11:108579969-108579991 ATACTTCAGGACATTGGTCTGGG + Intronic
1088419629 11:109630389-109630411 AAGTTCCAGGACATTGGTCTGGG - Intergenic
1088601997 11:111488517-111488539 ATGTTCTAGAACATTGGTCTGGG + Intronic
1089584071 11:119498842-119498864 ATCTTTCATCTCATTGGTCTGGG + Intergenic
1089887080 11:121837323-121837345 ATACTTCAGGACACTGGTCTGGG + Intergenic
1090109847 11:123895475-123895497 ATGCTTTAGGACATTGGTCTGGG + Intergenic
1090157218 11:124452651-124452673 ATGCTTCAGGACATTGGTAAAGG + Intergenic
1090175663 11:124647281-124647303 AGGTTTATGGGCATTGGTGTGGG - Intronic
1090525803 11:127534300-127534322 AAGTTTTATGACATTGGTCTTGG - Intergenic
1091684599 12:2552732-2552754 GGGTTGCAGGGCACTGGTCTTGG + Intronic
1091725387 12:2843086-2843108 ATGTGGCAGGGCACTGGACTGGG - Intronic
1091958206 12:4666458-4666480 AAGCTTCATGGCATTGGACTTGG - Intronic
1091964790 12:4730286-4730308 ATTTTCCAGGACATTGGTTTGGG - Intronic
1092324848 12:7519698-7519720 AATCTTCAGGACATTGGTCTGGG - Intergenic
1092439720 12:8489056-8489078 AAGTTTCGTGACATTGGTCTTGG + Intergenic
1092803439 12:12195762-12195784 ATGCTTCAGGACATTGGTCTGGG - Intronic
1092941696 12:13415034-13415056 ATGCTCCAGGACATTGGTCTGGG + Intergenic
1093330902 12:17837339-17837361 GTGTTTCAGGTCATTGGCCTGGG - Intergenic
1093343021 12:18002059-18002081 AAGCTTCATGACATTGGTCTGGG + Intergenic
1093365921 12:18298619-18298641 ATGTTCCAGAACATTGGTGTAGG - Intronic
1093579993 12:20775982-20776004 ATGCTTCAGGATATTGCTCTAGG + Intergenic
1093992009 12:25600366-25600388 ATTCTCCAGGACATTGGTCTGGG + Intronic
1094165990 12:27444414-27444436 ATACTCAAGGGCATTGGTCTGGG + Intergenic
1094213443 12:27916783-27916805 ATGCTTCAGGATATTGGTTTGGG + Intergenic
1094245155 12:28282778-28282800 ATGCTTCTGGACATTGGCCTAGG - Intronic
1094261850 12:28509341-28509363 TTGATTCATGGCATTGGTCTGGG + Intronic
1094763634 12:33564566-33564588 ATGCTTCTGAACATTGGTCTGGG + Intergenic
1094800292 12:34025039-34025061 GAGTTGCAGGGAATTGGTCTTGG + Intronic
1095156329 12:38859979-38860001 AAGTTTCATGACATTGGTCTTGG + Intronic
1095175342 12:39085438-39085460 ATGCTTCATGACATTGATCTGGG - Intergenic
1095181203 12:39148308-39148330 ATTCTTCAGGACATTGGACTAGG - Intergenic
1095499639 12:42822572-42822594 ATGCTTCATGACATTGGTCTGGG - Intergenic
1095546185 12:43373245-43373267 ATTTTGCCAGGCATTGGTCTGGG - Intronic
1095643431 12:44511900-44511922 ATGCTTCAGGACACAGGTCTAGG + Intronic
1095680250 12:44966299-44966321 ATTTTTCAGGACTTTGTTCTGGG + Intergenic
1095911852 12:47435603-47435625 ATGCTTCAAGACATTGGCCTAGG + Intergenic
1096043126 12:48537965-48537987 ACTCTTCTGGGCATTGGTCTAGG + Intergenic
1096442616 12:51657699-51657721 ACACTTCAGGACATTGGTCTGGG - Intronic
1096559047 12:52423072-52423094 ATGATTCAGGGCATGGGACCAGG - Intergenic
1096861520 12:54532113-54532135 ATTTTTGAAGGCATTGGTCATGG + Intronic
1096889544 12:54754557-54754579 ATGCTTCAGGACATTGGTCTGGG - Intergenic
1097645184 12:62227695-62227717 ACGCTTCAGGACATTGGTCTGGG - Intronic
1097977395 12:65701784-65701806 ATTAGTCAGGACATTGGTCTAGG - Intergenic
1098129460 12:67333946-67333968 ATGCTTCAGGACATTGGTCTAGG - Intergenic
1098215465 12:68211953-68211975 ACACTTCAGGACATTGGTCTGGG - Intronic
1098238846 12:68445040-68445062 ATGCTTCAGGACATTAGTCTGGG + Intergenic
1098396658 12:70026269-70026291 ACACTTCAGGACATTGGTCTAGG + Intergenic
1098733186 12:74064662-74064684 ATCTTTCAGGTCCTTGGTGTTGG - Intergenic
1098805197 12:75014127-75014149 ATTTTGCAAGGCATTGGTCAAGG - Intergenic
1099007625 12:77252897-77252919 ATGGTTCAGGACATTGGTCTGGG + Intergenic
1099091726 12:78318892-78318914 ACATTTCATGACATTGGTCTGGG - Intergenic
1099092899 12:78336339-78336361 ATACTCCAGGACATTGGTCTGGG + Intergenic
1099314903 12:81072037-81072059 ATTTTTCTGGACATTGGCCTAGG + Intronic
1099379915 12:81940693-81940715 ATTTTGCAAGGCATTGGTCAAGG + Intergenic
1099421279 12:82464183-82464205 ATGCTTCAGGATATTGCTCTGGG - Intronic
1099520362 12:83653002-83653024 ATGCTACAGGACATTGGTCTAGG + Intergenic
1099652810 12:85450265-85450287 ATGCTTCAGGACATTGGTCTGGG - Intergenic
1099655943 12:85491278-85491300 ATGCTTCATGACATTGGTATGGG - Intergenic
1099736308 12:86570658-86570680 ATGCTTCAGGACAATGGTCTAGG + Intronic
1099736699 12:86576399-86576421 AAGTCTCAGGACACTGGTCTGGG - Intronic
1099741703 12:86645236-86645258 ATATTTCTGGGTATTGGCCTGGG + Intronic
1100045356 12:90373594-90373616 ACTTTTCAGGACATTGATCTAGG - Intergenic
1100466626 12:94851450-94851472 ACACTTCAGGACATTGGTCTAGG + Intergenic
1100925205 12:99537830-99537852 ATTCTCCAGGACATTGGTCTGGG - Intronic
1101106133 12:101442483-101442505 ATGCTTCAGGACATTGGTCTGGG - Intergenic
1101167939 12:102058331-102058353 AAGTTGCACGACATTGGTCTGGG + Intronic
1101536326 12:105620398-105620420 ATGCTTCAGGACATTGGTCTGGG - Intergenic
1101636304 12:106545194-106545216 ATGTTTCATGACATTGGTATGGG + Intronic
1101745253 12:107536307-107536329 ATGCTTCAGGACATTGGTCTAGG + Intronic
1101798040 12:107994763-107994785 ATGCTTCGGGACATTGGTCTGGG - Intergenic
1102655051 12:114475492-114475514 ATGCTCCAGGACATTGGTCTGGG - Intergenic
1103055105 12:117813201-117813223 AGGCTTCAGAACATTGGTCTGGG + Intronic
1103147777 12:118610430-118610452 ATTTTTAAGGGTATTGGTGTGGG + Intergenic
1103169314 12:118800295-118800317 AAGTTCCATGACATTGGTCTGGG - Intergenic
1103460644 12:121102051-121102073 ATGTTCCAGGACATTGCTCTAGG + Intergenic
1105318135 13:19287850-19287872 ATGCTTCAGGACATTGGTCTAGG + Intergenic
1105565586 13:21544228-21544250 ATACTTCAGGACATTGGTTTGGG + Intronic
1105682232 13:22740612-22740634 ATGCTTCAGGACATTGGTGTAGG + Intergenic
1105850706 13:24333291-24333313 ATGCTTTACGACATTGGTCTTGG + Intergenic
1106000820 13:25721427-25721449 ATGCTTCAGGACACTGGTCTGGG - Intronic
1106073664 13:26438580-26438602 ATGCTTCAGGACATTGGTCTGGG + Intergenic
1106349574 13:28915868-28915890 ATGCTCCAGGACATTGGCCTGGG - Intronic
1106387032 13:29297019-29297041 ATACTTCGGGACATTGGTCTGGG - Intronic
1106829435 13:33563644-33563666 ATGCTTCAGGACATTGGTCTGGG + Intergenic
1106842775 13:33703160-33703182 ATGCTCCAGGACATTGGTCTGGG - Intergenic
1106919232 13:34545416-34545438 ATGCTCCAGGATATTGGTCTGGG - Intergenic
1107034932 13:35892034-35892056 ATGATTCAAGGCATTTATCTTGG + Intronic
1107050283 13:36040101-36040123 ATGCTTCTTGACATTGGTCTGGG + Intronic
1107142352 13:37015078-37015100 ATGCTTCAGGACATTGGATTTGG + Intronic
1107294918 13:38898245-38898267 AAACTTCAGGACATTGGTCTGGG - Intergenic
1107386998 13:39921702-39921724 GTGTTTCAAGATATTGGTCTGGG - Intergenic
1107754527 13:43605724-43605746 ATTCTTCAGGACATTGGACTGGG + Intronic
1107953627 13:45487309-45487331 ATGTTTTAGGACATTGGTCTAGG + Intronic
1108034603 13:46275870-46275892 ATGTTTCAGGACATTGACCTAGG - Intronic
1108037186 13:46303318-46303340 ACACTTCAGGACATTGGTCTGGG + Intergenic
1108880491 13:55108129-55108151 ATGCTTCAGGACATTGGTGTAGG + Intergenic
1108890284 13:55249962-55249984 TTGCTTCAGGACATTGGTATGGG + Intergenic
1109156511 13:58917207-58917229 AAGTTTCAGGACATTGGATTTGG + Intergenic
1109290095 13:60463429-60463451 ATGCTTCAAGACATTGGTCTGGG + Intronic
1109333512 13:60961887-60961909 ATGTTTCCTGGCATTGGTATGGG - Intergenic
1109376813 13:61505976-61505998 ATATTTCAGGTCATTGTTCTGGG + Intergenic
1109426397 13:62169561-62169583 ATGCTCAAGGACATTGGTCTGGG - Intergenic
1109861323 13:68202436-68202458 AAGTTTCATGACAATGGTCTTGG - Intergenic
1109985868 13:69984073-69984095 ATGGTTCATGACATTGGTCTGGG + Intronic
1110005873 13:70267819-70267841 ATTTTTCAGTGCAGTGCTCTGGG - Intergenic
1110007927 13:70295310-70295332 AAGTTTCATGGCATTGGTCTAGG + Intergenic
1110088452 13:71412751-71412773 ATTTTTCAGGATATTGATCTAGG - Intergenic
1110245172 13:73315320-73315342 ACACTTTAGGGCATTGGTCTGGG + Intergenic
1110376927 13:74804536-74804558 ATTTTGCAAGGCATTGGTCAAGG - Intergenic
1110388894 13:74948644-74948666 ATTCTCCAGGACATTGGTCTGGG + Intergenic
1110501801 13:76237117-76237139 AGTCTTCAGGACATTGGTCTGGG + Intergenic
1110519074 13:76453619-76453641 ATGCTTCAGAACATTGGTCTGGG + Intergenic
1110528293 13:76565705-76565727 ATGCTTCATGGCATTATTCTTGG + Intergenic
1111283239 13:86054173-86054195 ATATCTAAGGGCATTTGTCTAGG - Intergenic
1111289611 13:86147708-86147730 ATGCTTCAGGATATTGGCCTGGG + Intergenic
1111466115 13:88613294-88613316 ATATTTTAGGACATTGTTCTAGG - Intergenic
1111583168 13:90250934-90250956 ATGCTACAGAACATTGGTCTGGG - Intergenic
1111819918 13:93199942-93199964 ACTCTTCTGGGCATTGGTCTAGG + Intergenic
1111876450 13:93903135-93903157 ATGCTACATGACATTGGTCTGGG + Intronic
1112083954 13:96008104-96008126 ATGCTCCAGGACATTGGTCTGGG + Intronic
1112117494 13:96372556-96372578 AAGTTCCATGACATTGGTCTGGG - Intronic
1112419616 13:99236122-99236144 ATGCTCCAGGACGTTGGTCTGGG + Intronic
1112821278 13:103339049-103339071 ATACTTCAGGACATTGGTCTAGG + Intergenic
1112821340 13:103340031-103340053 ATACTTCAGGACATTGGTCTAGG - Intergenic
1113355277 13:109573467-109573489 ATGCTTCAGAACATTGGTATGGG + Intergenic
1114207491 14:20586591-20586613 ATGTATCAGGTCTTTGGTCAAGG - Intronic
1114331817 14:21645011-21645033 ATATTTAAGGGCTTTGGACTTGG + Intergenic
1114687315 14:24545878-24545900 ATTATCCAGGACATTGGTCTTGG - Intergenic
1114762836 14:25335833-25335855 ACATTTTAGGACATTGGTCTAGG + Intergenic
1114783346 14:25565175-25565197 ACTTTACAGGACATTGGTCTGGG - Intergenic
1115033123 14:28822457-28822479 AAGTTTCTTGACATTGGTCTTGG + Intergenic
1116016116 14:39409159-39409181 AAGCTTCTTGGCATTGGTCTTGG - Intronic
1116247000 14:42428107-42428129 AAGTTCCAGGACTTTGGTCTGGG + Intergenic
1116378572 14:44234156-44234178 AAGTTCCATGACATTGGTCTGGG + Intergenic
1116401859 14:44516699-44516721 ATACTCCAGGACATTGGTCTGGG - Intergenic
1116445234 14:45001321-45001343 ATACTTCAGGACATTGGTCTGGG + Intronic
1116579342 14:46619080-46619102 ATGATCCAGGACATTTGTCTGGG - Intergenic
1116616041 14:47140750-47140772 ATGCTTCATGACATTGGTCTGGG + Intronic
1117013306 14:51492502-51492524 ACGTTTAAGGGGATAGGTCTCGG - Intronic
1117224832 14:53645165-53645187 AAGTTTCAAGACATTGGCCTGGG - Intergenic
1117306879 14:54486381-54486403 TTGCTTCAGGACATTGGTCTGGG + Intronic
1117399547 14:55346093-55346115 ATGTTTTATGGTCTTGGTCTTGG + Intronic
1117633866 14:57722434-57722456 ATTTTGCAAGGCATTGGTCAAGG - Intronic
1117771252 14:59136435-59136457 ATGTTTCTGGGAAGGGGTCTGGG - Intergenic
1117848739 14:59943227-59943249 ATACTTCAGGACATTGATCTAGG - Intronic
1117902244 14:60547035-60547057 ATGCTTTAGGACATTGGCCTGGG - Intergenic
1118033748 14:61843477-61843499 ACATTTCAGGACATTGGCCTGGG - Intergenic
1118115020 14:62765760-62765782 AATCTCCAGGGCATTGGTCTGGG + Intronic
1118515013 14:66517859-66517881 ATGTTTCAGGACATTGGTCTGGG + Intronic
1118573286 14:67215920-67215942 ATGGTTTAGGGCATTTGTTTTGG - Intronic
1119072413 14:71600185-71600207 ATGCTCCAGGACATTGGTTTAGG - Intronic
1119107834 14:71940795-71940817 ATTTTGCAAGGCATTGGTCAAGG + Intronic
1119152881 14:72380238-72380260 ATGCTTCAGGACATTGGCCTGGG + Intronic
1119312238 14:73657976-73657998 ACACTTCAGGACATTGGTCTAGG - Intronic
1120082287 14:80229496-80229518 ATTTTGCAAGGCATTGGTCAAGG + Intronic
1120386734 14:83855821-83855843 ATGTTTAACAGCATTGGTATAGG + Intergenic
1120423788 14:84321469-84321491 ATATTTCTGGATATTGGTCTAGG + Intergenic
1120451189 14:84668737-84668759 ATATTTCAAGACATTGGTCTGGG - Intergenic
1120636783 14:86962787-86962809 ACTCTTCAGGACATTGGTCTGGG - Intergenic
1121609495 14:95267094-95267116 ATGCTCCAGGACATTGGTTTGGG + Intronic
1122148948 14:99713513-99713535 ATGCTCCAGGACATTGGTGTAGG + Intronic
1122351768 14:101099561-101099583 AAGTTTCACGACATTCGTCTAGG - Intergenic
1122586860 14:102813983-102814005 ATGCTTCATCACATTGGTCTGGG - Intronic
1123161600 14:106283649-106283671 ATTTTTCGGGACATTGGCCTAGG + Intergenic
1202934120 14_KI270725v1_random:68313-68335 ATGCTCCAGGACATTAGTCTGGG - Intergenic
1202934669 14_KI270725v1_random:75766-75788 ATCCTTCAGGACATTGCTCTGGG + Intergenic
1124077115 15:26456630-26456652 AGTTTTCAGAGCATGGGTCTAGG + Intergenic
1124146538 15:27132206-27132228 ATGCTACATGACATTGGTCTGGG - Intronic
1124793903 15:32757152-32757174 AATCTTCAGGACATTGGTCTGGG - Intergenic
1125837025 15:42761250-42761272 ATGTTTCAGAACACTGGTCTAGG + Intronic
1126219864 15:46200205-46200227 ATGTTCCAGGACATTGGCCTGGG + Intergenic
1126272905 15:46843631-46843653 ATGCTTCAGGACATTGGTCTGGG - Intergenic
1126480661 15:49116154-49116176 ATGCTTCAGGGGATTGGCATAGG + Intronic
1126497716 15:49310963-49310985 ATGCTTCAGGACACTGGTATAGG - Intronic
1126630858 15:50733583-50733605 ATGCTCCAGGACATTGGTCTTGG + Intronic
1126654548 15:50962671-50962693 ATGCTTTAGGACATTGGTCGAGG + Intronic
1126828589 15:52575832-52575854 ATGCTCCAGGACATTGGTCCGGG - Intergenic
1127222609 15:56896129-56896151 ATTATTTTGGGCATTGGTCTTGG - Intronic
1127239493 15:57097029-57097051 AGGTTTCAGTGGATTTGTCTGGG + Intronic
1127699784 15:61487371-61487393 ATGCTTCAGGACATGGATCTGGG - Intergenic
1127740928 15:61904051-61904073 ATGCTTTAGGACACTGGTCTAGG + Intronic
1128006326 15:64245169-64245191 ATGCTTCATGACATTGGTCTGGG + Intronic
1128359578 15:66952575-66952597 ATGCTTTAGGACATTGGTCCAGG - Intergenic
1128503620 15:68248718-68248740 ATGCTCCAGGACATTGGTCAGGG + Intronic
1128935159 15:71739775-71739797 ATGTCCCAGAGCATTGGTTTGGG + Intronic
1129501851 15:76046732-76046754 ATGTTCCATGACATTGGTCTGGG + Intronic
1129639541 15:77360942-77360964 ATGCTCCAGGACACTGGTCTGGG + Intronic
1129802495 15:78426238-78426260 ATGCTTCAGAACATTAGTCTGGG - Intergenic
1129922480 15:79331475-79331497 ACACTTCAGGACATTGGTCTGGG + Intronic
1129963084 15:79706811-79706833 ATACTCCAGGACATTGGTCTGGG - Intergenic
1130174252 15:81551307-81551329 ATGCTTCAGGACACTTGTCTAGG + Intergenic
1130606221 15:85319409-85319431 ATGTTCCAGGACATTGCTCTGGG + Intergenic
1130663071 15:85845936-85845958 ATGCTCCAGGACATTGGTCTGGG + Intergenic
1130665744 15:85868370-85868392 ATGCTTCAGGACACTGATCTGGG - Intergenic
1131005714 15:88976195-88976217 ATGCTTCAGAACATTGCTCTAGG - Intergenic
1131703152 15:94962684-94962706 ATGCTTCATGACATTGGGCTGGG + Intergenic
1131722298 15:95183468-95183490 ATGTTCCAGGACATTGGTCTGGG - Intergenic
1132200404 15:99950057-99950079 AAGTTTGATGACATTGGTCTGGG - Intergenic
1132264355 15:100454635-100454657 ATACTTCAGGACATTGGTCTAGG + Intronic
1133082467 16:3333768-3333790 ATGCTCCAGGACATTGATCTAGG - Intergenic
1134074784 16:11283020-11283042 ATGGTGCAGGGCACTGGTCATGG + Intronic
1134641434 16:15832241-15832263 ATGGTTCAGGGACTTGGGCTTGG + Intronic
1134915451 16:18066622-18066644 AATCTTCAGGACATTGGTCTGGG + Intergenic
1136603602 16:31315354-31315376 AAGCTTCATGACATTGGTCTGGG - Intronic
1137026732 16:35484057-35484079 ATGCTTCTGGACATTGGCCTGGG + Intergenic
1137224295 16:46487986-46488008 ATGCTTCAGTACCTTGGTCTAGG + Intergenic
1137385398 16:48037461-48037483 ATGTTCTAGGACATTGGTCTGGG + Intergenic
1137470603 16:48753275-48753297 ATGCATCAGGACATTGGTTTGGG + Intergenic
1137643187 16:50051422-50051444 ATGCTTCAGGACATTGGTCTAGG + Intergenic
1138176715 16:54906592-54906614 AAGTATCAAGACATTGGTCTTGG + Intergenic
1138893317 16:61172036-61172058 ACACTTCAGGGTATTGGTCTGGG + Intergenic
1138994957 16:62439524-62439546 ATATGTCAGGACATTGGTCTGGG + Intergenic
1139171975 16:64641617-64641639 ATCTTTCATGACATTGATCTTGG - Intergenic
1140145751 16:72306313-72306335 ATGTTTAAGGACACTGGTCTGGG - Intergenic
1140226954 16:73085748-73085770 ACACTTCAGGACATTGGTCTGGG + Intergenic
1140325686 16:74000243-74000265 ATGCTCTAGGGCATTTGTCTAGG - Intergenic
1140543221 16:75779497-75779519 ATGCTCCAGGACATTGATCTGGG + Intergenic
1141226842 16:82125139-82125161 ATCTTTCAAGACATTGGACTGGG + Intergenic
1141306557 16:82869899-82869921 ATACTCCAGGACATTGGTCTTGG + Intronic
1141350902 16:83295296-83295318 AAGTTCCATGACATTGGTCTAGG + Intronic
1143328044 17:6113407-6113429 ATATTTCAGGACATTGGTCTGGG + Intronic
1143891951 17:10108888-10108910 ACACTTCAGGACATTGGTCTAGG + Intronic
1144613154 17:16743159-16743181 ATGCTTCAGGACATTGGTCAAGG - Intronic
1144812966 17:18012737-18012759 ATGCTTTAGGACATTGGCCTGGG + Intronic
1144899586 17:18572148-18572170 ATGCTTCAGGACATTGGTCAAGG + Intergenic
1145096019 17:20027497-20027519 ACGCTTCAGGACATTGGTCCAGG - Intronic
1145132814 17:20373238-20373260 ATGCTTCAGGACATTGGTCAAGG - Intergenic
1146313822 17:31791801-31791823 AGTTTTCAGGGCATTGGACATGG + Intergenic
1146888680 17:36490158-36490180 ATGCTTCAGGACATTGGTCTAGG - Intronic
1147519125 17:41151987-41152009 AAGATTCATGACATTGGTCTCGG - Intergenic
1148177514 17:45580072-45580094 CTGTTTAAGGGGATTGGTGTGGG - Intergenic
1148605479 17:48926119-48926141 AGGTTTCTGGGCATTGCTCCAGG - Intronic
1149106312 17:52971488-52971510 ATGCTTCAGGATATTGGTCTGGG + Intergenic
1149232312 17:54549255-54549277 ATGCTTCAGAACATTGGTCTAGG - Intergenic
1149363602 17:55918732-55918754 AAGCTTCATGACATTGGTCTTGG + Intergenic
1150867889 17:68873622-68873644 AAGCTTCATGACATTGGTCTTGG - Intronic
1150982285 17:70156037-70156059 ATGTTTCATAGCATTACTCTAGG + Intergenic
1151204758 17:72498110-72498132 ATGATTCTGGGGTTTGGTCTAGG - Intergenic
1153080050 18:1212108-1212130 ATATTTCAGGACAGTAGTCTGGG - Intergenic
1153113878 18:1630543-1630565 ATGTTTCATGACATTGGACTTGG + Intergenic
1153648492 18:7217351-7217373 ATGTTTCATGACCTTGGTCTAGG - Intergenic
1154258439 18:12806862-12806884 ACACTTCAGGACATTGGTCTGGG + Intronic
1154308639 18:13249821-13249843 ATGCTTCAAGACATTGGTCCAGG - Intronic
1154368038 18:13729046-13729068 ATGCTTCAAGACACTGGTCTGGG - Intronic
1154512674 18:15125047-15125069 ATGTATCAGGACATTGTGCTGGG + Intergenic
1154944899 18:21152380-21152402 ATGCTTCAGGATATTGATCTAGG - Intergenic
1155047976 18:22120293-22120315 ATGCTTCAAGACATTGGTCTAGG - Intergenic
1155137980 18:23015530-23015552 ATGTTTCAGGACAATGGTCTGGG - Intronic
1155392043 18:25349340-25349362 ATCTTTCAGGCCCTGGGTCTAGG + Intronic
1155665945 18:28308289-28308311 ACTTTTCTGGACATTGGTCTAGG + Intergenic
1155736714 18:29233210-29233232 ATCTTTCATGGCATTGGATTTGG + Intergenic
1155755706 18:29492950-29492972 ATGTGTGAGTGCATTGATCTTGG - Intergenic
1155810638 18:30229149-30229171 ATGCTTCAGCACTTTGGTCTAGG + Intergenic
1155849759 18:30757492-30757514 ATGCTTCAGGACATTTGTCTAGG + Intergenic
1156277683 18:35599291-35599313 ATGCCTCAGGACATTGGTCTGGG - Intronic
1156344943 18:36248513-36248535 CTGCTTCAAGACATTGGTCTGGG - Intronic
1156433746 18:37103572-37103594 ACATTTTAGGACATTGGTCTTGG + Intronic
1156618909 18:38825204-38825226 ATGCTTCAGGATATTGGTCTGGG + Intergenic
1156645276 18:39154512-39154534 ATGCTTCAGGACATTGATTTGGG + Intergenic
1156672969 18:39492617-39492639 ATGTTTCACAACATTGGGCTGGG + Intergenic
1156972881 18:43178594-43178616 ATGCTACAGGACATTGATCTGGG + Intergenic
1157398322 18:47363162-47363184 ACACTTCAGGACATTGGTCTAGG - Intergenic
1157656504 18:49395057-49395079 ATGCTTCAGCACATTGGTCTGGG + Intronic
1158016900 18:52793711-52793733 ATGCTTCAGGAAATTGGTCTAGG - Intronic
1158096301 18:53775493-53775515 ATGTTCCAGAACATTGGGCTGGG - Intergenic
1158470954 18:57736394-57736416 ATGTTTTAGGACATTGGTCTAGG - Intronic
1158677088 18:59529779-59529801 CTGTTTCTGGTCATTGATCTTGG + Intronic
1158767856 18:60477033-60477055 ACGTTTCAGGACATTGGTCCAGG - Intergenic
1158948589 18:62469876-62469898 ATGCTCCAGGACATTGGTCTGGG - Intergenic
1159080968 18:63735477-63735499 ATGTTCCAGGACATTTGTGTGGG + Intergenic
1159178451 18:64869443-64869465 ATGCCTCAGGACATTGATCTAGG - Intergenic
1159334760 18:67048076-67048098 ATGTTTCAGGATATTGGTCTGGG - Intergenic
1159559337 18:69977119-69977141 ATTTTGCAAGGCATTGGTCAAGG + Intergenic
1159572239 18:70129693-70129715 ATGCTTCAGGACATTAGCCTGGG + Intronic
1159705543 18:71681676-71681698 ATGCTTCGGGATATTGGTCTGGG - Intergenic
1159710809 18:71757187-71757209 AATATTCAGGACATTGGTCTGGG + Intronic
1160127366 18:76188824-76188846 ATGCTTCATGACATTGGCCTGGG - Intergenic
1160606467 18:80054116-80054138 ATCCTTCTGGTCATTGGTCTAGG + Intronic
1160888667 19:1365328-1365350 AAGTTGCAGGTCATTGGTTTGGG + Intronic
1162277557 19:9669032-9669054 ACAATCCAGGGCATTGGTCTGGG + Intronic
1162312778 19:9917001-9917023 ATCTTTCAGGGCTTTGTCCTGGG + Intronic
1162614125 19:11782868-11782890 ATACTTCAGGACATTGGTTTAGG + Exonic
1162836690 19:13323842-13323864 AAGCTCCATGGCATTGGTCTCGG - Intronic
1163148449 19:15397926-15397948 CTGTTTCAGGGCTTGTGTCTGGG - Intronic
1164892369 19:31835354-31835376 ACTCTTCAGGACATTGGTCTGGG + Intergenic
1165250382 19:34528269-34528291 ATGCTTCAAGACATTGATCTGGG - Intergenic
1165260293 19:34609393-34609415 AATTTTCAGGACATTGGTCTTGG - Intronic
1165271981 19:34716996-34717018 AATTTTCAGGACATTGGTCTTGG + Intergenic
1165547274 19:36551029-36551051 ATGATTCAGGTCTTTGTTCTAGG - Intronic
1166016850 19:39987660-39987682 ATACTTCAGGACATTGGTCTAGG + Intronic
1166577898 19:43861380-43861402 ATGTTTCAGGACACTGGTCTGGG + Intergenic
1166598196 19:44070267-44070289 ATGTTCCAGGACATTGGTCTGGG - Intergenic
1167522475 19:49963849-49963871 ACTCTTCAGGACATTGGTCTAGG - Intergenic
1167763923 19:51467793-51467815 ATGCTTCAGGTCATTTGTCTAGG + Intergenic
1167880077 19:52450247-52450269 ACTCTTCAGGGCATTGATCTGGG - Intronic
1168198537 19:54794998-54795020 ACTCTTCTGGGCATTGGTCTGGG - Intronic
1168479311 19:56705308-56705330 GTGCTTCAGGACATTGGTCTGGG + Intergenic
1168551049 19:57294798-57294820 ATGCTTCTGGATATTGGTCTGGG - Intergenic
925325408 2:3017152-3017174 ATGCTTCAGGACATTGGTCTAGG + Intergenic
925417977 2:3686052-3686074 ATGCTCTAGGACATTGGTCTTGG - Intronic
925506203 2:4568259-4568281 ACTCTTCAGGACATTGGTCTAGG - Intergenic
925538283 2:4939500-4939522 CTGTTTTAGGGCATGTGTCTGGG - Intergenic
926248156 2:11136201-11136223 AAGCTTCATGACATTGGTCTTGG - Intronic
926602400 2:14859753-14859775 ATGCTCCAGGACATTGGTCTGGG + Intergenic
926940228 2:18127935-18127957 TTTTTTCAGGACATTGGTTTGGG + Intronic
927040986 2:19230123-19230145 GTGTTTCAGGGCATGGATTTGGG + Intergenic
927044964 2:19268465-19268487 ATGCCCCAGGACATTGGTCTGGG + Intergenic
927221996 2:20721043-20721065 ATGCTACAGGACATTGGTCTGGG + Intronic
928067471 2:28180533-28180555 ATGCTACAGGACATTGGTTTAGG + Intronic
928476848 2:31635630-31635652 ATGTTCTAGGACGTTGGTCTGGG - Intergenic
929084155 2:38151543-38151565 ATGCTTCAGGACATTGATCTAGG + Intergenic
929233399 2:39582926-39582948 ATGCTCCAGGACATTGGTCTGGG - Intergenic
929690868 2:44072028-44072050 ATGCTTCAGGAGATTGGTCTAGG - Intergenic
929699602 2:44150663-44150685 AGGTTTCAGGGGATAGGCCTGGG + Intergenic
929729135 2:44467923-44467945 ATGCTTCAGGGCATTGGTCTGGG + Intronic
930161413 2:48161085-48161107 ACGTGTTAGGACATTGGTCTAGG + Intergenic
930182124 2:48370867-48370889 ACACTTCAGGACATTGGTCTGGG - Intronic
930254451 2:49074104-49074126 GTGCTTCAGAGCATTGGTCTGGG + Intronic
930496382 2:52149623-52149645 ATCTGTCAGGGCTTTTGTCTTGG + Intergenic
930618013 2:53614168-53614190 ATGCTTTAAGACATTGGTCTAGG - Intronic
930679893 2:54245928-54245950 AAGTTCCAGGACATTGGTCTGGG - Intronic
930778919 2:55203727-55203749 ATTCTCCAGGACATTGGTCTCGG + Intronic
930862720 2:56091736-56091758 AGGTTTCACTGCATTGGACTGGG + Intergenic
930968551 2:57364404-57364426 AATCTCCAGGGCATTGGTCTGGG + Intergenic
931345570 2:61442178-61442200 ATGCTTCAGGACATCGGTCTGGG + Intronic
931530161 2:63204924-63204946 ATGCTCCAGGGCATTGGTCTGGG - Intronic
931574053 2:63700937-63700959 ATACTCCAGGACATTGGTCTTGG + Intronic
932101516 2:68904925-68904947 ATACTTCAGGACATTGATCTGGG + Intergenic
932223361 2:70018840-70018862 AAGCTTCATGACATTGGTCTGGG + Intergenic
932717784 2:74115021-74115043 ATGCTTCAGGACATTGGTCTAGG + Intergenic
932889949 2:75585439-75585461 ATGCTCCAGGACATTGGTCAGGG + Intergenic
932932530 2:76058987-76059009 ATTCTTCTGGACATTGGTCTTGG - Intergenic
932946087 2:76233229-76233251 ATGTTTTATGACATTGGTTTGGG - Intergenic
932946807 2:76243775-76243797 ATGCTTTAGGACATTGGTCTAGG - Intergenic
933345612 2:81081531-81081553 ACACTTCAGGACATTGGTCTGGG + Intergenic
933549647 2:83760011-83760033 ACATTTCAGGATATTGGTCTAGG - Intergenic
933570819 2:84009440-84009462 ATGCTTCAAGACATTGATCTGGG + Intergenic
934062667 2:88310074-88310096 AAGTTTCATGACATTGGTGTTGG + Intergenic
934306578 2:91828534-91828556 ATCCTTCAGGACATTGCTCTGGG - Intergenic
934307131 2:91836021-91836043 ATGCTCCAGGACATTAGTCTGGG + Intergenic
934326126 2:92016693-92016715 ATGCTCCAGGACATTAGTCTGGG - Intergenic
934326678 2:92024208-92024230 ATCCTTCAGGACATTGCTCTGGG + Intergenic
934464477 2:94247343-94247365 ATGCTCCAGGACATTAGTCTGGG - Intergenic
934465051 2:94254759-94254781 ATCCTTCAGGACATTGCTCTGGG + Intergenic
934996776 2:98969489-98969511 ACACTTCAGGTCATTGGTCTGGG - Intergenic
935182078 2:100700504-100700526 AAGTATCTGGCCATTGGTCTGGG - Intergenic
935508473 2:103938403-103938425 ATGCTTGAGGACATTGATCTGGG - Intergenic
935826040 2:106950800-106950822 ATACTTCAGGACATTGGTCTAGG - Intergenic
935834403 2:107035553-107035575 TTGCTTCATGACATTGGTCTGGG + Intergenic
935964250 2:108457052-108457074 ATGCATCAAGACATTGGTCTAGG - Intronic
936631559 2:114208522-114208544 ATGCTTCAGGATATTGGTCTTGG + Intergenic
936759271 2:115755581-115755603 ATGCTTAAGGACATTGGTCTAGG + Intronic
936815989 2:116461401-116461423 ATTCTTCAGGACATTGATCTGGG + Intergenic
936830435 2:116638633-116638655 ATGCTTGAAGACATTGGTCTAGG + Intergenic
936884222 2:117289903-117289925 ATGCTTCAGGACATTGGTCTTGG + Intergenic
936952158 2:117988649-117988671 ATCTTTCAGGACATTGCACTTGG - Intronic
937403136 2:121602876-121602898 ATGTTTCAGGACATTAGTCTGGG + Intronic
937545305 2:123010161-123010183 ATACTTCAAGGCATTGGTCTAGG + Intergenic
937568474 2:123327339-123327361 AAGTTTCATGGCATTAATCTTGG + Intergenic
937785452 2:125889671-125889693 ATTTTGCATGGCATTGGTCAAGG + Intergenic
938505068 2:131871301-131871323 ATTCATCAGGACATTGGTCTAGG - Intergenic
938512917 2:131969682-131969704 ATGTATCAGGACATTGTGCTGGG + Intergenic
938575752 2:132602459-132602481 ATGCTTCAGGATGTTGGTCTAGG + Intronic
938844302 2:135192949-135192971 AGGCTTCAAGGCATTGGACTTGG + Intronic
938962195 2:136353870-136353892 ATGTGCCAGGGCCTTGATCTTGG + Intergenic
939058310 2:137389642-137389664 ACTTTTCTGGACATTGGTCTAGG - Intronic
939080071 2:137649347-137649369 ATGCTCCAGGATATTGGTCTGGG - Intronic
939263525 2:139840771-139840793 AATTTCCAGGGCATTGGTCTGGG - Intergenic
939890958 2:147735685-147735707 ACACTTCAGGACATTGGTCTGGG + Intergenic
940104193 2:150079551-150079573 ACATTTCAGGACATTGGTCTAGG + Intergenic
940186521 2:150991068-150991090 ATGCTTTAGGACATTGATCTGGG + Intergenic
940189349 2:151023095-151023117 ATACTTCAGGACGTTGGTCTGGG + Intronic
940267701 2:151857334-151857356 GTCTTTCAGGCCATTGGTATTGG - Intronic
940310134 2:152270005-152270027 AAGCTTCATGACATTGGTCTTGG + Intergenic
940425807 2:153530955-153530977 AAACTTCAGGACATTGGTCTGGG + Intergenic
940570292 2:155423801-155423823 ACACTTCAGGACATTGGTCTGGG - Intergenic
940573916 2:155475571-155475593 AAGTTTCATGGCATCGGTCTTGG + Intergenic
941117207 2:161485970-161485992 ATGCTTCAGGACATTAGTCTGGG + Intronic
941130163 2:161638202-161638224 ATGCTTCATGATATTGGTCTGGG - Intronic
941946582 2:171105072-171105094 ACACTTCAGGGCATTGGTCTAGG + Intronic
942375818 2:175336115-175336137 ATTCTTCAGGTCATTAGTCTAGG - Intergenic
942909230 2:181221797-181221819 AAGTTTCAGGATATTGGACTGGG - Intergenic
943236610 2:185329196-185329218 ATTCTTCAGGACATTGGTCTAGG - Intergenic
943301259 2:186204439-186204461 ATGCTTGAGGACATTAGTCTGGG + Intergenic
943659155 2:190539033-190539055 ACGTTTCAGGACATTGATTTGGG - Intergenic
943667362 2:190623731-190623753 ATGCTTCGGGACACTGGTCTAGG + Intergenic
943714721 2:191137926-191137948 ATGCTTCAGGACATTGGTCTAGG + Intronic
943913619 2:193599979-193600001 AATCTTCAGGCCATTGGTCTGGG + Intergenic
943970526 2:194399507-194399529 ATGCTTCAGGACATTGATCTGGG - Intergenic
944102371 2:196041626-196041648 ATGCTTCAGGAGATTGGTCTGGG + Intronic
944156772 2:196615772-196615794 ATGCTCCAGTACATTGGTCTAGG - Intergenic
944754673 2:202748349-202748371 ATGTTTCAGCACATTGGTCTAGG + Intronic
944772560 2:202929256-202929278 ATGCTTCAGGACATTGGTCTAGG - Intronic
944842919 2:203641683-203641705 AATTTCCAGGACATTGGTCTGGG - Intergenic
945111021 2:206359855-206359877 ATCCTTCAGGACATTGGACTGGG + Intergenic
945170256 2:206988319-206988341 GTGTTCCAGGGGATGGGTCTGGG + Intergenic
945174599 2:207029697-207029719 ATGCTTTGGGACATTGGTCTGGG + Intergenic
945271147 2:207941539-207941561 ATGCTTCAGAACATTGGCCTGGG + Intronic
945384769 2:209184144-209184166 ATGCTTCAGGATATTTGTCTAGG - Intergenic
945389865 2:209251732-209251754 AAGTTTCATGACATTGGTCTTGG + Intergenic
945973116 2:216249662-216249684 ACGCTCCAGGACATTGGTCTGGG + Intergenic
946127354 2:217574761-217574783 ATACTTCAGGACATTGGTCTGGG + Intronic
946606008 2:221405817-221405839 ATGTTACAGAACATTGATCTGGG - Intergenic
946635605 2:221722146-221722168 ATGCTTTATGACATTGGTCTAGG - Intergenic
946704203 2:222441587-222441609 ATGTTTCCAGGGATTGTTCTTGG + Intronic
947007109 2:225524667-225524689 ATGCCTCTGGACATTGGTCTAGG + Intronic
947040604 2:225914855-225914877 ATGCTCCAGAACATTGGTCTGGG - Intergenic
947044360 2:225963320-225963342 ACACTTCAGGACATTGGTCTGGG + Intergenic
1168934739 20:1654600-1654622 AAGTTTCATGACATTGGTCTTGG + Intronic
1169185052 20:3608279-3608301 ATCCTTCAGGACATTGGTCTGGG - Intronic
1169296674 20:4405972-4405994 ATTTTCCAGTGCCTTGGTCTTGG - Intergenic
1169855430 20:10096735-10096757 ATGCTTCAGGACATTGGCCTGGG + Intergenic
1170050407 20:12137318-12137340 ATGCTTCAGGACTTTGGTCTGGG - Intergenic
1170063148 20:12281662-12281684 ACCCTCCAGGGCATTGGTCTAGG + Intergenic
1170122773 20:12928115-12928137 ATGATGCAGTGCATTGGCCTGGG - Intergenic
1170146228 20:13177829-13177851 ATGCTTCAGGACATTGGTCTGGG + Intergenic
1170170860 20:13410901-13410923 ATACTTCAGGACATTGGTTTAGG - Intronic
1170240306 20:14158501-14158523 ATACTTCAGGACATTAGTCTAGG - Intronic
1170384393 20:15800357-15800379 ATGCTTCAGGACATTGGTCTAGG - Intronic
1170410612 20:16086836-16086858 ATGCTTCAGGACATTGGTCTAGG + Intergenic
1170733066 20:18990607-18990629 AATTTTCAGGGCATAGGGCTGGG - Intergenic
1170748915 20:19126788-19126810 AAGTTTCTTGACATTGGTCTGGG - Intergenic
1170927103 20:20734724-20734746 ATGACTTAGGGCTTTGGTCTGGG - Intergenic
1171241528 20:23571253-23571275 ACATTTCAGGACATTGGTGTGGG - Intergenic
1171507482 20:25650036-25650058 ATGCTCCAGGACATTGGTCTGGG - Intergenic
1171725247 20:28612239-28612261 ATGTTATATGTCATTGGTCTGGG - Intergenic
1171752822 20:29070843-29070865 ATGTTATATGTCATTGGTCTGGG + Intergenic
1171789443 20:29506723-29506745 ATGTTATATGTCATTGGTCTGGG - Intergenic
1172797328 20:37550092-37550114 ATCCTTCAGGACATTGGTCTGGG - Intergenic
1172924772 20:38523174-38523196 AGTTTTCATGGCCTTGGTCTAGG + Intronic
1173196447 20:40917624-40917646 AAGCTTCATGACATTGGTCTTGG + Intergenic
1173270970 20:41534507-41534529 ATGTTTGGGAGCATTGGACTAGG - Intronic
1173772699 20:45676815-45676837 AAGCTTCATGACATTGGTCTTGG - Intergenic
1173780861 20:45756301-45756323 ATTAGTCAGGACATTGGTCTTGG + Intronic
1174101838 20:48132720-48132742 AAATTTCATGACATTGGTCTTGG - Intergenic
1175438162 20:58969927-58969949 ATGCTCCAAGACATTGGTCTCGG + Intergenic
1176595522 21:8690478-8690500 ATGCTCCAGGACATTAGTCTGGG - Intergenic
1176596082 21:8697978-8698000 ATCCTTCAGGACATTGCTCTGGG + Intergenic
1176780854 21:13193152-13193174 ATGTATCAGGACATTGTGCTGGG - Intergenic
1177036477 21:16049794-16049816 AATCTCCAGGGCATTGGTCTGGG + Intergenic
1177101763 21:16906722-16906744 GTACTTCAGGGCATTGTTCTAGG + Intergenic
1177246192 21:18527395-18527417 ATGCTTTAGGGCACTGGTCTTGG - Intergenic
1177363480 21:20103897-20103919 ATTTTGCAAGGCATTGGTCAAGG - Intergenic
1177389144 21:20443835-20443857 AGGTTTCAGTGAATTGCTCTTGG - Intergenic
1177468555 21:21523262-21523284 ATTCTTCAGGACATTGGTCTGGG - Intronic
1177624134 21:23636974-23636996 ATGTTTCAGGACACTGGTCTGGG - Intergenic
1177933945 21:27318876-27318898 ATTTTGCAAGGCATTGGTCAAGG + Intergenic
1177978532 21:27882261-27882283 ATGTATCAGGACATTGTGCTGGG - Intergenic
1177987166 21:27990767-27990789 ATTCATCAGGACATTGGTCTAGG + Intergenic
1178243805 21:30933102-30933124 ATGCTACAAGACATTGGTCTAGG + Intergenic
1178260208 21:31092741-31092763 ATGCTCCAGGACATTAGTCTGGG - Intergenic
1178980652 21:37261346-37261368 ATGCTCCAGGACATTGGTCTGGG - Intronic
1179473569 21:41628627-41628649 ATGCTTTAGGACATTGGTCTGGG + Intergenic
1179946330 21:44679955-44679977 ATGCTCCAGGACATTGGTCTAGG + Intronic
1180010371 21:45046004-45046026 ATCTTCCAGGACCTTGGTCTTGG - Intergenic
1180278384 22:10667625-10667647 ATGCTCCAGGACATTAGTCTGGG - Intergenic
1180278993 22:10675427-10675449 ATCCTTCAGGACATTGCTCTGGG + Intergenic
1180409616 22:12592906-12592928 ATGTTATATGTCATTGGTCTGGG + Intergenic
1180585638 22:16886485-16886507 ATGCTCCAGGACATTAGTCTGGG - Intergenic
1180586204 22:16893954-16893976 ATCCTTCAGGACATTGCTCTGGG + Intergenic
1182402650 22:30092578-30092600 ATGCTTCAGGACATTGGTCTGGG - Intronic
1182701340 22:32241695-32241717 ATGCTTCAGGACATTGGTCTGGG - Intronic
1183134201 22:35871208-35871230 ATATTTTAGAGCATAGGTCTTGG - Intronic
1183186972 22:36297647-36297669 ATGTGTAAGGACATTTGTCTAGG + Intronic
1183285475 22:36959885-36959907 ATGTTTCAGGGCATGGCTGTGGG - Intergenic
1184305403 22:43597169-43597191 ATGCTACAGGACATTGGTCAGGG + Intronic
949170294 3:988534-988556 ATTTTGCAAGGCATTGGTCAAGG + Intergenic
949417908 3:3833144-3833166 ATTTTGCAGGGCATTGGTCAAGG + Intronic
950128579 3:10526611-10526633 TTGGTTCTGGGCATGGGTCTGGG - Intronic
950717072 3:14855949-14855971 ATGCTTCAGGGCATTGGTCTGGG - Intronic
950867083 3:16197668-16197690 GGGTTTCAGGGTATTCGTCTGGG + Intronic
951176089 3:19601955-19601977 ATGCTATAGGACATTGGTCTGGG + Intergenic
951314637 3:21174238-21174260 ATGTTTCAGGACATTAGTCTGGG - Intergenic
951480402 3:23155393-23155415 ATGTTTTAAGACCTTGGTCTGGG + Intergenic
951625536 3:24658536-24658558 ATTCTTCAGGACATTAGTCTAGG - Intergenic
951652990 3:24973049-24973071 ATGCTTCAGGACGTTGGTCTGGG - Intergenic
951797407 3:26555649-26555671 ATGCTCCAGGGCATTGGTGTGGG + Intergenic
951900406 3:27652494-27652516 ATACTTCAGGACATTGGTCTGGG - Intergenic
951965164 3:28374063-28374085 ATGCTTGAGGACATTGGTCTGGG - Intronic
952143707 3:30508053-30508075 ATGCTTCAGGACATTGATGTAGG + Intergenic
952277186 3:31888385-31888407 ATGCTGCAGGACCTTGGTCTGGG + Intronic
952429759 3:33211809-33211831 ATGCTTCAGGATATTGGTCTGGG - Intronic
952514148 3:34087149-34087171 ATGCTTCAGGACATTGGTTTGGG + Intergenic
952562978 3:34617384-34617406 ACATTACAGGCCATTGGTCTGGG - Intergenic
953013172 3:39047445-39047467 ATGCTTCAGGACATTGGCCTGGG + Intergenic
953031917 3:39185147-39185169 ATGGTTGAGGGCATTGAGCTTGG + Exonic
953280704 3:41553171-41553193 ATTCTTCAGGACATTGGTCTAGG + Intronic
953285767 3:41607023-41607045 ATGCTTCAGGACATTGATCTAGG - Intronic
953587185 3:44213374-44213396 AGATTTCATGGCATTGGTCTGGG + Intergenic
953630646 3:44613693-44613715 ATGCTTTAGGACATTGGTCTAGG + Intronic
954469605 3:50681035-50681057 ATGCTTCAGGACATTGGTCTAGG - Intronic
955030981 3:55217847-55217869 ATGCTTCAGGACATTGGTCTAGG - Intergenic
955256952 3:57342183-57342205 ATGCTTCAGGACATTGGTCCTGG + Intronic
955431664 3:58852036-58852058 ATGGTTTTGGGCATTGGTCAAGG - Intronic
955501446 3:59588151-59588173 ATATTCCAGGACACTGGTCTGGG + Intergenic
955622812 3:60883780-60883802 ATGCTTCTGGGCATTGGTCTGGG + Intronic
955847965 3:63187478-63187500 ATGTTTCAGGATATTGGTCTAGG - Intergenic
956385082 3:68708386-68708408 ATGTTTCAGGATATTGGTGTGGG - Intergenic
956400253 3:68871497-68871519 ATGCTTCAAGACATTGGTCCGGG + Intronic
956689544 3:71863353-71863375 ATCTTTCAGTGCCTTGATCTTGG - Intergenic
956855093 3:73268382-73268404 ATGCTACAGGACATTGGCCTGGG - Intergenic
956912935 3:73839452-73839474 ATGTTTTAGGACATTGACCTGGG + Intergenic
957013623 3:75037406-75037428 ATCTTTCTGGACATTGGTTTAGG - Intergenic
957369796 3:79278757-79278779 ATGCTTCAGAACATTGGCCTGGG + Intronic
957645673 3:82921658-82921680 ATGCTCCAGGACATTGGTCTGGG - Intergenic
957754357 3:84467434-84467456 ATTTTGCAAGGCATTGGTCAGGG - Intergenic
958014466 3:87922595-87922617 ATGCTGCAGGACATTGGCCTGGG - Intergenic
958524531 3:95238662-95238684 AAGCTTCATGGCATTGGTTTTGG - Intergenic
958606625 3:96365913-96365935 ATACTTCAGGACATTGGTCTAGG + Intergenic
958631807 3:96694125-96694147 ATTCTCTAGGGCATTGGTCTGGG - Intergenic
958763872 3:98341579-98341601 AAGCTTCATGGCATTGGTCTTGG - Intergenic
958789094 3:98630543-98630565 ATTTTGCAAGGCATTGGTCAAGG + Intergenic
958837901 3:99168461-99168483 ACTTTTTAGGTCATTGGTCTGGG + Intergenic
958920116 3:100095689-100095711 ACTTTTCAAGACATTGGTCTGGG + Intronic
958960917 3:100508886-100508908 ACACTTCAGGGCATTGGTCTAGG + Intronic
959016571 3:101141107-101141129 ATGCTCCAGGACATTGGCCTAGG - Intergenic
959038654 3:101395219-101395241 ATGCTTGTGGACATTGGTCTAGG - Intronic
959092610 3:101920128-101920150 ATGATTCAGGACATTGGCATGGG - Intergenic
959229122 3:103624721-103624743 ACATTCCAGGACATTGGTCTGGG - Intergenic
959272951 3:104237180-104237202 ATATTATAGGACATTGGTCTGGG - Intergenic
959364957 3:105445896-105445918 ATGCTTCATGACATTGGTCTGGG + Intronic
959377642 3:105605121-105605143 ATTTTGCAAGGCATTGGTCAAGG + Intergenic
959407901 3:105983629-105983651 ATGTTTCATGACATTGGTCTAGG - Intergenic
959706693 3:109344547-109344569 TTGCTTCAGGACATTGGTTTGGG - Intergenic
959722296 3:109505686-109505708 ATGCTTCAGGACGTTGGCCTGGG + Intergenic
959741200 3:109722009-109722031 AATTTTCTGTGCATTGGTCTAGG - Intergenic
959779611 3:110213601-110213623 ATGCTTCAGGGTCTTGGTCTTGG + Intergenic
959905473 3:111706442-111706464 ATGCTTCAAGACATTGGTCTAGG - Intronic
960086830 3:113600353-113600375 GTGTTTCATTGTATTGGTCTCGG - Intronic
960540818 3:118860682-118860704 ATGCTTCAGGACATTGTTCTAGG - Intergenic
960581645 3:119284140-119284162 GTGCTTCAGGACATTTGTCTGGG - Intergenic
960866452 3:122205151-122205173 ATGCTTCGGGACATTGGTCTGGG - Intronic
961060989 3:123828523-123828545 ATGCCTCAGAACATTGGTCTGGG + Intronic
961124893 3:124408394-124408416 ATGGTTAAGAGCATTGGACTTGG + Intronic
961321542 3:126080134-126080156 ATTTTGCAGGACATTGGTCTGGG + Intronic
961398774 3:126618630-126618652 ATCCTTCTGGACATTGGTCTAGG + Intronic
961963352 3:130876199-130876221 ATGCTTCTGGACATTGGTCTAGG - Intronic
962211684 3:133484659-133484681 ATGTTCCAGGACATTGAGCTGGG - Intergenic
962291350 3:134139143-134139165 ATGCTTCAGGACATTGGTCTGGG + Intronic
962472557 3:135725033-135725055 ATGCTTCATGACATTGGTCAGGG - Intergenic
962822552 3:139065947-139065969 ATATTTTAGGACATTGGTCTAGG - Intronic
962834575 3:139176695-139176717 AAGTTTCTTGACATTGGTCTTGG - Intronic
963191000 3:142473171-142473193 AAGGTTCATGGCATTGGTTTGGG - Intronic
963551077 3:146723682-146723704 AAGCTTTAGGACATTGGTCTAGG + Intergenic
963879311 3:150510826-150510848 ATATTTCAAGACATTGGTCTAGG + Intergenic
964148199 3:153491932-153491954 CTTCTTCAGGACATTGGTCTGGG + Intronic
964150302 3:153516749-153516771 ATGCTCCAGGGCATTGGCCTAGG - Intergenic
964274354 3:154993014-154993036 ATGCTTCAGAACATTGGTCATGG + Intergenic
964319239 3:155477314-155477336 AATTTCCAGGACATTGGTCTAGG + Intronic
964456210 3:156869779-156869801 ATAATTCAGGACATTGATCTAGG - Intronic
964611036 3:158615365-158615387 ACATTTCAGGACATTGGTATGGG - Intergenic
964927984 3:161979877-161979899 ATGCTATAGGACATTGGTCTTGG - Intergenic
965111500 3:164430091-164430113 ATGCTTCAGGACAGTGATCTGGG - Intergenic
965604926 3:170488766-170488788 AATCTTCAGGACATTGGTCTGGG + Intronic
965631417 3:170736995-170737017 ACACTTCAGGACATTGGTCTAGG + Intronic
965956224 3:174373223-174373245 GTGTTTCAGGACGTTGATCTGGG + Intergenic
966217290 3:177516901-177516923 TTGTTTCATAGCATTGGTTTTGG + Intergenic
966296099 3:178425363-178425385 ACACTTCAGGACATTGGTCTAGG - Intronic
966459289 3:180157724-180157746 ATCCTTCAGGACATTGGTCTGGG - Intergenic
966517970 3:180840368-180840390 ATGCTCCATGACATTGGTCTGGG - Intronic
966546973 3:181160283-181160305 AAGTTTCATGACATTGGTCTTGG - Intergenic
966664566 3:182456686-182456708 ATGCTTCAGAACATAGGTCTGGG - Intergenic
967006175 3:185385014-185385036 ATGCTTCAGTACATGGGTCTAGG - Intronic
967279723 3:187810208-187810230 ATGTTTCAGATCCTTGGTATTGG - Intergenic
967454699 3:189670950-189670972 ATGCTTTAGGACATTGGTCTAGG + Intronic
967786017 3:193496986-193497008 ACGTTTCATGACATTGGTCTGGG + Intronic
968012825 3:195298014-195298036 ATTTTTCAGGGAAATGGTTTGGG - Intronic
968617750 4:1587312-1587334 AAGCTTCATGACATTGGTCTGGG - Intergenic
968719529 4:2190448-2190470 ATGCTCCAGTGCATTTGTCTGGG + Intronic
969177253 4:5408041-5408063 ATCTGTCAGGGCCTTGATCTTGG + Intronic
969282405 4:6179537-6179559 TTGTGTCAGGGCAATGGGCTTGG - Intronic
969921680 4:10545988-10546010 AGGTTTCAGGGGATAGGACTGGG - Intronic
969990508 4:11257764-11257786 AAGTTTTATGACATTGGTCTAGG - Intergenic
970043856 4:11827647-11827669 ATGCTTCAGGACATTGGTCTGGG - Intergenic
970077087 4:12234983-12235005 ATGCTTTAGGACATTGGTCTTGG - Intergenic
970089444 4:12388304-12388326 ATTTTGCAAGGCATTGGTCAAGG + Intergenic
970142507 4:12997599-12997621 AAGTTACATGGCATAGGTCTGGG - Intergenic
970173836 4:13316739-13316761 ATACTTCAGGACATTGGTATGGG - Intergenic
970173884 4:13317404-13317426 ATGCTTCAAGACATTGGTCTGGG - Intergenic
970180608 4:13388438-13388460 AAGCTTCAGGTCATTGGACTTGG + Intronic
970329977 4:14971024-14971046 ATGCTTCAGAAAATTGGTCTGGG + Intergenic
970783030 4:19762109-19762131 ATGTTTCAGGACATTGGTTTGGG - Intergenic
971230303 4:24795943-24795965 ATGTTGCATGGCTTTGGTGTCGG + Intronic
971703017 4:30005345-30005367 GTGCTTCAGGGCATTGGTCTAGG - Intergenic
971710900 4:30111197-30111219 ACTCTTGAGGGCATTGGTCTGGG + Intergenic
971755852 4:30707363-30707385 ATACATCAGGGCATTGGTCTAGG - Intergenic
971845327 4:31911883-31911905 ACACTTCAGGACATTGGTCTGGG - Intergenic
971895127 4:32582360-32582382 ATTTATCAGGGCATTTGTCAAGG - Intergenic
972049263 4:34708075-34708097 ATATTTCAGGACATTGGTCTAGG + Intergenic
972049572 4:34712118-34712140 AATTTCCAGGACATTGGTCTGGG + Intergenic
972121074 4:35704202-35704224 ATGCTTCAGGACATTGGTCTGGG - Intergenic
972122220 4:35718514-35718536 ATTTTTCAGGACATATGTCTAGG + Intergenic
972147387 4:36044611-36044633 AAGCTCCATGGCATTGGTCTGGG + Intronic
972264670 4:37447760-37447782 ATGTTTCAGGTCATATCTCTCGG - Exonic
972384007 4:38546174-38546196 ACTCTCCAGGGCATTGGTCTTGG - Intergenic
972415643 4:38837664-38837686 ATGCTTGAGGACACTGGTCTAGG + Intronic
972646346 4:40971100-40971122 ATGTTTCATAGCCTTGGTATAGG - Intronic
972760710 4:42101062-42101084 ATGTTTCATGACATTGGTCTGGG - Intergenic
972951025 4:44322660-44322682 ATGCTACAGGACATTGGCCTGGG - Intronic
972955414 4:44383744-44383766 ATGCTTCAGGACACTGGTCTGGG + Intronic
972988088 4:44790200-44790222 AAGCTCCAGGACATTGGTCTGGG - Intergenic
972993769 4:44853441-44853463 ATGCTTCAAGACACTGGTCTGGG - Intergenic
973025978 4:45271635-45271657 ATGCTTCAGGGCATTGGTCTGGG + Intergenic
973043623 4:45507003-45507025 AGGCTTCATGACATTGGTCTTGG - Intergenic
973074652 4:45907665-45907687 ATGTTCCAGGACATTGTGCTGGG + Intergenic
973545429 4:51976636-51976658 ATGCTTCAGGACATTTGTCTAGG + Intergenic
973922112 4:55697745-55697767 ATGCTTCACAGCAATGGTCTGGG + Intergenic
974290500 4:59923615-59923637 ACACTTCAGGACATTGGTCTGGG + Intergenic
974405245 4:61460149-61460171 ATGCTTCAGGACATTGGTCTAGG - Intronic
975531999 4:75409503-75409525 ATGCTTCAGGACATTGGTCTGGG - Intergenic
975636409 4:76453945-76453967 AAGTTTCATGACATTGGACTTGG - Intronic
975920747 4:79383354-79383376 ACACTTCAGGGCATTGGTCTAGG + Intergenic
976024268 4:80668378-80668400 ATGCTCCAGGATATTGGTCTGGG - Intronic
976136427 4:81942164-81942186 ACACTCCAGGGCATTGGTCTGGG + Intronic
976999341 4:91476982-91477004 ATGCTCCAGGACAGTGGTCTAGG + Intronic
977012295 4:91653052-91653074 ACTCTTCAGTGCATTGGTCTAGG - Intergenic
977033597 4:91920278-91920300 ACGCTCCAGGACATTGGTCTTGG - Intergenic
977051611 4:92135291-92135313 ATTTTACAGGACATTAGTCTAGG + Intergenic
977364412 4:96049147-96049169 ATGCTTCATTACATTGGTCTGGG + Intergenic
977367568 4:96090275-96090297 ATACTTGAGGACATTGGTCTTGG + Intergenic
977410657 4:96658136-96658158 ATGCTTCAGTACATTGGTCTGGG + Intergenic
977465747 4:97381448-97381470 ATTTTGCAAGGCATTGGTCAAGG - Intronic
977821967 4:101482720-101482742 ATGCTACAGGACATTGGTCTAGG - Intronic
977829605 4:101575265-101575287 ATACTTCAGGACATTGGTCTAGG - Intronic
977841965 4:101718091-101718113 ATGCTTCAGGATATTGGTCTGGG + Intronic
977982542 4:103341792-103341814 AAGTTTCATGAGATTGGTCTGGG + Intergenic
978020145 4:103798652-103798674 ATGCTTCAGGACATTGGTCTGGG - Intergenic
978209555 4:106119581-106119603 ATGCTTCAGGACACTGGTCTGGG + Intronic
978422767 4:108551460-108551482 ACTCTTCTGGGCATTGGTCTAGG + Intergenic
978661491 4:111132343-111132365 AATCTTCAGGGCATTGGTCTGGG - Intergenic
979422453 4:120522034-120522056 ACTTTCCAGGACATTGGTCTGGG + Intergenic
979515624 4:121606734-121606756 AAGCTTCATGGCATTGATCTTGG - Intergenic
979539590 4:121866294-121866316 ATGCTTTAGGACATTGGTCTGGG - Intronic
979541541 4:121889210-121889232 ATACTTCAGGACACTGGTCTGGG + Intronic
979542165 4:121897209-121897231 ATGCTTCAGGACACTGGTCTGGG + Intronic
979813344 4:125066051-125066073 ATGCTTCAGGACATTGGGGTAGG + Intergenic
979849783 4:125561383-125561405 ACACTTCAGGGCATTGGTTTAGG - Intergenic
979873594 4:125858211-125858233 AAGTTTCATGACATTGGACTTGG - Intergenic
979875032 4:125878426-125878448 ATGCTTCAGGACACTGGTGTAGG + Intergenic
979980105 4:127244332-127244354 ATGTAACAAGACATTGGTCTGGG + Intergenic
980017560 4:127669874-127669896 ATGCTTCTGGACATTGGCCTAGG + Intronic
980150930 4:129048057-129048079 ATGTTTCAGTACATTTTTCTGGG - Intronic
980166124 4:129229984-129230006 ATGCTTCACGTCATTGGTCTGGG + Intergenic
980297220 4:130937041-130937063 ATGCTTCAGGAGATTAGTCTGGG - Intergenic
980323246 4:131306451-131306473 AACTTTCAGGACATTGGTCCAGG + Intergenic
980324292 4:131322286-131322308 AAGCTTAAGGACATTGGTCTAGG + Intergenic
980432544 4:132722894-132722916 ATGATTCAGGACATTTGTCTTGG - Intergenic
980497783 4:133607333-133607355 ATTTTGCAAGGCATTGGTCAAGG + Intergenic
980769150 4:137349489-137349511 ATGCTTTAGGACATTGGCCTGGG + Intergenic
980771816 4:137383172-137383194 AAGCTCCATGGCATTGGTCTGGG - Intergenic
980808102 4:137839401-137839423 ATGCTTCAGAACATTGGTCTAGG + Intergenic
980864169 4:138535185-138535207 ACACTTCAGGACATTGGTCTAGG + Intergenic
981142622 4:141287238-141287260 ATATTTCAGGACATTGGTCTAGG - Intergenic
981177254 4:141696022-141696044 ATGTTTCATGACATTTGGCTTGG - Intronic
981285490 4:143013614-143013636 ATGCTTCAGGACATTTGTCTGGG - Intergenic
981397029 4:144263612-144263634 ATGCTACAGGGCATTGATCTGGG + Intergenic
981564513 4:146084907-146084929 ACACTTCAGGACATTGGTCTAGG + Intergenic
981850086 4:149219312-149219334 ATGTTGGCGGGCATAGGTCTGGG - Intergenic
981889838 4:149722367-149722389 ATTTTTCTGGACATTGGCCTAGG - Intergenic
981901055 4:149864033-149864055 ACAATTCAGGGTATTGGTCTGGG + Intergenic
981921854 4:150094120-150094142 AAGTTTCATGACATTAGTCTTGG + Intronic
982531711 4:156552977-156552999 ACACTTCAGGACATTGGTCTAGG - Intergenic
982618330 4:157671420-157671442 ATGTTTCGTGACAGTGGTCTGGG + Intergenic
982910951 4:161142537-161142559 ATATTTCTGAACATTGGTCTTGG + Intergenic
982947667 4:161647073-161647095 AAGCCTCATGGCATTGGTCTTGG - Intronic
982984573 4:162189910-162189932 AAGTTCCATGGCATTGGTCTGGG - Intergenic
983312654 4:166084457-166084479 AAGTTCCATGACATTGGTCTGGG - Intronic
983456073 4:167966713-167966735 ATGCTTCAAGCCATTAGTCTAGG - Intergenic
983463939 4:168062804-168062826 ATGCATCAGGATATTGGTCTGGG + Intergenic
983965106 4:173800241-173800263 AAGCTTCAGGACCTTGGTCTGGG - Intergenic
984053996 4:174903647-174903669 ATGCTTCAGGACATTGGTGTGGG - Intronic
984728539 4:183044357-183044379 AGGCTTCATGACATTGGTCTGGG + Intergenic
985221415 4:187709652-187709674 ATGCTCCAGGACATTGGTCAGGG + Intergenic
985332165 4:188849977-188849999 ATGCTTCAGGACATTGGTCTAGG - Intergenic
985335843 4:188893085-188893107 ATGTTCCAGGACATTGGTCTGGG - Intergenic
985435347 4:189925527-189925549 ATGTTATATGTCATTGGTCTGGG + Intergenic
986409106 5:7458991-7459013 ATGATTTAAGCCATTGGTCTTGG - Intronic
986890281 5:12295733-12295755 AGGCTTCATGGCATTGGTCTTGG - Intergenic
987009190 5:13743394-13743416 ATGCTTCAGGACACTGGTCTGGG + Intronic
987151997 5:15051643-15051665 ACACTTCAGGACATTGGTCTGGG - Intergenic
987152920 5:15059709-15059731 ATTTTGCAAGGCATTGGTCAAGG - Intergenic
987161303 5:15146293-15146315 ATGCTTCAGGACATTGGTCTAGG + Intergenic
987189401 5:15458910-15458932 ATGGTCTAGGGCATTAGTCTGGG - Intergenic
987439405 5:17937812-17937834 ACACTTCAGGACATTGGTCTAGG + Intergenic
987589020 5:19898722-19898744 ATGTTTCATGACATTGGGCTTGG + Intronic
987643286 5:20638686-20638708 AACTTTCAGGGCATAGATCTAGG + Intergenic
987686214 5:21206478-21206500 ATGCTGCAGGGCATGGGTATAGG - Intergenic
987865556 5:23531233-23531255 ATGCTTCAGGACATCAGTCTAGG + Intergenic
988148902 5:27350020-27350042 ATGTTTCAAGAAATTGGTCCTGG - Intergenic
988155648 5:27446522-27446544 ATACTTCAGGACATTAGTCTAGG - Intergenic
988209197 5:28180909-28180931 ATGTTTCAGGACATTCATCCAGG - Intergenic
988313397 5:29591778-29591800 ATGTTGCTTGACATTGGTCTTGG + Intergenic
988414106 5:30924113-30924135 AAGCTCCATGGCATTGGTCTGGG + Intergenic
988626214 5:32877726-32877748 ATTCTTCAGGACATTTGTCTGGG - Intergenic
988630453 5:32925263-32925285 ATTTTCCAAGGCATTGGGCTAGG - Intergenic
988893065 5:35640271-35640293 ATCTGTCAGAGCTTTGGTCTGGG - Intronic
989029695 5:37105581-37105603 ACATTTCAGGACACTGGTCTAGG + Intergenic
989231328 5:39090283-39090305 ACACTTCAGGACATTGGTCTAGG + Intergenic
989249673 5:39296097-39296119 ATGCTTCAGGACATTGGTCAGGG + Intronic
989321391 5:40138450-40138472 AAGCTTCATGACATTGGTCTGGG - Intergenic
989494461 5:42095690-42095712 ATGCTTCAGGACATTGGTCTGGG - Intergenic
989515972 5:42343768-42343790 AAACTTCAGGACATTGGTCTAGG + Intergenic
989553670 5:42765830-42765852 ATTCTCCAGGACATTGGTCTGGG + Intronic
990070130 5:51772249-51772271 ATGCTTCATGACATTAGTCTGGG + Intergenic
990103375 5:52221527-52221549 ATTCTTCTGGACATTGGTCTAGG - Intergenic
990400714 5:55434825-55434847 ACGCTTCAGGATATTGGTCTGGG + Intronic
990760213 5:59121116-59121138 ACACTTCAGGACATTGGTCTAGG + Intronic
990769354 5:59225086-59225108 AAATTTCATGGCATTGGTCTTGG - Intronic
990912989 5:60872222-60872244 ATGCTCCATGACATTGGTCTGGG + Intergenic
990921194 5:60969796-60969818 ACTTTCCAGGACATTGGTCTTGG - Intronic
990991923 5:61694138-61694160 AAGCTTCATGACATTGGTCTTGG + Intronic
991205702 5:64048007-64048029 AAATCTCAGGACATTGGTCTGGG + Intergenic
991287929 5:65000398-65000420 ACATTTCAGGGCATTGGTCCAGG - Intronic
991667274 5:69011731-69011753 TTGGCTGAGGGCATTGGTCTGGG - Intergenic
991687961 5:69199024-69199046 AAATGTCAGGGCTTTGGTCTAGG + Intronic
992036255 5:72780926-72780948 ATGCTTTAGGACATTGGTCTGGG + Intergenic
992257865 5:74939658-74939680 ATTCTTCTGGGCATTGATCTAGG + Intergenic
992317859 5:75577497-75577519 ATGTTTCTTGGCATTGCTTTTGG - Intronic
992649642 5:78845954-78845976 ATGCTTCAGAACATTGGTCTGGG - Intronic
993046801 5:82875978-82876000 ATGCTTAAGGACATAGGTCTAGG - Intergenic
993076340 5:83236631-83236653 GTGATTCAGGACATTTGTCTGGG + Intronic
993203171 5:84845621-84845643 ATACTTTAGGACATTGGTCTCGG + Intergenic
993228300 5:85199000-85199022 ATGCTCCAGGGCATTGATCTGGG - Intergenic
993341726 5:86732154-86732176 ATACTTCAGGACAATGGTCTAGG - Intergenic
993345679 5:86779366-86779388 ATGTTTCAGGACATTGGTTTGGG - Intergenic
993699856 5:91105852-91105874 ATGCTTTAGAACATTGGTCTAGG + Intronic
993791534 5:92216960-92216982 ACTTTTCAAGGCATTGGTCAAGG - Intergenic
993846314 5:92948316-92948338 ACACTTCAGGACATTGGTCTAGG - Intergenic
993941971 5:94069355-94069377 ACATTTCAGGACACTGGTCTAGG + Intronic
994000043 5:94768323-94768345 ATACATCAGGACATTGGTCTAGG + Intronic
994134642 5:96271678-96271700 ATGCTCCAGGACATTGGTCTGGG + Intergenic
994274350 5:97817500-97817522 AATATTCAGGACATTGGTCTTGG - Intergenic
994291631 5:98033931-98033953 ATTTTGCAAGGCATTGGTCAAGG + Intergenic
994444137 5:99851449-99851471 AAGCTTCATGACATTGGTCTTGG + Intergenic
994550385 5:101227326-101227348 ACTTTTCAGGACATTGGCCTAGG - Intergenic
994562976 5:101400392-101400414 ATGTTTTAGGACATTAGTCTTGG - Intergenic
994731285 5:103494313-103494335 ATGTTTCTTGATATTGGTCTTGG - Intergenic
994866296 5:105276072-105276094 ACACTTCAGGACATTGGTCTAGG + Intergenic
995086189 5:108112476-108112498 ATATTTCTGGGCCTTGTTCTGGG - Intronic
995129879 5:108619033-108619055 AAGCTTCATGACATTGGTCTGGG + Intergenic
995175828 5:109175516-109175538 ATGCTTCAGGACATTGGTCTAGG + Intronic
995213273 5:109565272-109565294 ATGCTACAGGACATTGGTCTGGG - Intergenic
995606008 5:113855763-113855785 ATATTCCAGGACATTGGCCTGGG - Intergenic
995704069 5:114967499-114967521 ATGCTTTTGGACATTGGTCTTGG + Intergenic
995777561 5:115740604-115740626 ATGTTCCAGGACATTGGTCTGGG - Intergenic
996040431 5:118803776-118803798 AACATTCAGGACATTGGTCTAGG + Intergenic
996041384 5:118816850-118816872 ATGCTTCAGGTCATTGGTCTAGG + Intergenic
996361028 5:122646702-122646724 ATACTTCAGGACACTGGTCTGGG + Intergenic
996684243 5:126263021-126263043 ATTTTTCAGGACATTGGTCTAGG + Intergenic
996829379 5:127722532-127722554 ATGCTCCAGGACATTGTTCTGGG - Intergenic
996970828 5:129365922-129365944 GTGCTTCAGGACATTGGTTTGGG + Intergenic
996999243 5:129739585-129739607 ATTTTTGAGGGTATTGGTCGAGG + Intergenic
998181235 5:139945317-139945339 ATGCTTCAGGACATTGGTCTGGG - Intronic
998550372 5:143071545-143071567 ATGCTTCAGGACATTTTTCTGGG + Intronic
998637101 5:143967940-143967962 AAGTCTCAGAGCATTGGTCCTGG + Intergenic
999485033 5:151986534-151986556 ATGCTTCAGGACATTTGTCTGGG - Intergenic
999538371 5:152544071-152544093 ATGGTCCAGGACATTGGTGTAGG + Intergenic
999817134 5:155188488-155188510 ATGCTCCAGGACATTGGTCTGGG - Intergenic
1001443874 5:171767969-171767991 TTGTTTCAGGGAAGAGGTCTAGG + Intergenic
1001612312 5:173012828-173012850 ACTCTTCAGAGCATTGGTCTAGG + Intronic
1001790344 5:174451575-174451597 ATGCTTCAGGACATTGGTCTGGG + Intergenic
1002035052 5:176461872-176461894 ATCATTCTGGACATTGGTCTTGG - Intronic
1002678776 5:180942854-180942876 ATGCTTCAGGACATTGGACTGGG + Intronic
1002680363 5:180957620-180957642 ATGCTTCAGGACATTGATCTGGG - Intergenic
1003410774 6:5860742-5860764 AAGCTTCATGACATTGGTCTTGG + Intergenic
1003711275 6:8593259-8593281 ATGCTTCAGGACATTGGTCTGGG + Intergenic
1003758347 6:9148087-9148109 ATTTTGCAAGGCATTGGTCAAGG - Intergenic
1004356935 6:14937903-14937925 ATGTTTTAAGACATTGGTCTGGG - Intergenic
1004458633 6:15815201-15815223 ATGCTCCAGGACATTGGTCTTGG - Intergenic
1004875744 6:19951552-19951574 ATGCTTCATGACATTGGGCTGGG - Intergenic
1005219403 6:23569557-23569579 ATGTTAAAGGGCATTGCTATTGG + Intergenic
1005593568 6:27353948-27353970 ATGCTTCAGGGCTTTAGTCTAGG + Intergenic
1005623481 6:27641887-27641909 AAGCTTTAGGACATTGGTCTTGG + Intergenic
1005635412 6:27748781-27748803 AAGCTTCAGAACATTGGTCTTGG - Intergenic
1005832952 6:29685656-29685678 AATTCTCAGGGCATTGGCCTAGG - Intergenic
1006190892 6:32208036-32208058 ATGCTTCAAGACATTGGTCTGGG + Intronic
1006614265 6:35314842-35314864 ATATTCCAGGACATTGGTCTGGG - Intronic
1006675737 6:35761647-35761669 ACACTTCAGGACATTGGTCTGGG + Intergenic
1007115206 6:39338638-39338660 ATGGTTCTGGGCTGTGGTCTGGG - Intronic
1007815178 6:44517704-44517726 ACTCTTCAGGACATTGGTCTAGG - Intergenic
1008239538 6:49092465-49092487 ATGTTTCAGGACATTGATCTAGG - Intergenic
1008257195 6:49317758-49317780 ATGCTTCATGACATTGGTGTAGG + Intergenic
1008545832 6:52582384-52582406 AAGCTTCATGGCATTAGTCTGGG + Intergenic
1008672420 6:53784855-53784877 ATGCTTCAGGACATTAGTTTAGG + Intergenic
1008680978 6:53872022-53872044 ATGCTTCATGGCATTGGTCTGGG - Intronic
1008726161 6:54422963-54422985 AAGTTTCATGACATTGCTCTTGG + Intergenic
1008924038 6:56873408-56873430 ATGCCTCAGTACATTGGTCTAGG - Intronic
1008936537 6:56998683-56998705 ATGCTTCATGACATTGGTCTGGG + Intronic
1009265401 6:61548356-61548378 ATGTTTCTGAGCACTGGTTTAGG - Intergenic
1009294923 6:61934372-61934394 ATGCTTCATGACATTGGTCTGGG - Intronic
1009409895 6:63354063-63354085 ACACTTTAGGGCATTGGTCTAGG + Intergenic
1009514431 6:64596775-64596797 ATGCCTCAGGACATTGGTATAGG + Intronic
1009654556 6:66524231-66524253 ATGTTTTATGGCATTGTTTTAGG + Intergenic
1009673984 6:66793048-66793070 ATATTTCAGGACATTGGTATAGG + Intergenic
1009705795 6:67250084-67250106 ATGCTTCATGACATTGATCTGGG + Intergenic
1009742425 6:67763757-67763779 ATGTTTCTTGACATGGGTCTGGG + Intergenic
1009788100 6:68364243-68364265 ATTCCTCAGGGTATTGGTCTTGG + Intergenic
1009788241 6:68366019-68366041 ACACTTCAGGACATTGGTCTAGG - Intergenic
1009797735 6:68494357-68494379 ATGTTTTAGGACATTGGTCTAGG + Intergenic
1009803649 6:68573996-68574018 ATGCTGCAGGACATTGTTCTGGG + Intergenic
1010008245 6:71020109-71020131 ATGCTTCATGACATTGGGCTGGG + Intergenic
1010130013 6:72480705-72480727 ATGCTTCACGACAATGGTCTGGG + Intergenic
1010290904 6:74136111-74136133 ATGCTTCAAGACATTGGTCTGGG + Intergenic
1010328378 6:74592005-74592027 AATCTTCAGGACATTGGTCTGGG + Intergenic
1010441227 6:75896969-75896991 TTGTTGCAGTGTATTGGTCTAGG + Intronic
1010558140 6:77310758-77310780 TTCTTTCAGGTGATTGGTCTTGG - Intergenic
1010775965 6:79886156-79886178 AGTTTTCAGGACATTGGTCTGGG + Intergenic
1010821476 6:80420469-80420491 ACATTTCAGGGCACTGCTCTAGG - Intergenic
1010837065 6:80601626-80601648 ATTCTACAGGGCATTGGACTTGG - Intergenic
1010857973 6:80866917-80866939 ATGCTTCAAGACATTGGTCCGGG + Intergenic
1011209037 6:84934868-84934890 ATAATTTAGGACATTGGTCTGGG + Intergenic
1011286770 6:85733102-85733124 ACCTTTCAGGTAATTGGTCTAGG + Intergenic
1011317138 6:86047835-86047857 ATACTTCAGGACATTGGTCTGGG - Intergenic
1011369671 6:86622118-86622140 ATTCTTCAGGACATTGTTCTTGG - Intergenic
1011387828 6:86816308-86816330 ATGCTGCAGGACATTGGTCTGGG + Intergenic
1011446773 6:87449897-87449919 ATGTTTCAGGGCATTGGTCTGGG - Intronic
1011523253 6:88234194-88234216 AAATTTCATGACATTGGTCTGGG + Intergenic
1011636209 6:89376110-89376132 ATGCTTCAGGGCAGTAATCTTGG + Intronic
1012256416 6:97038088-97038110 ATGCTCCAGGACATTGGACTGGG + Intronic
1012361551 6:98388654-98388676 ACTTTTCTGGGCATTGGCCTAGG - Intergenic
1012502743 6:99907451-99907473 ATGATTTAGGACATTGGTCTGGG + Intergenic
1012505086 6:99936272-99936294 ATGCTCCAGGACATTGGTCTGGG - Intronic
1012755251 6:103222725-103222747 ATGCTCCAGGATATTGGTCTGGG - Intergenic
1012782938 6:103586159-103586181 AAATTCCAGGACATTGGTCTGGG - Intergenic
1012962127 6:105633133-105633155 ATGGTTCATGACATTTGTCTTGG + Intergenic
1013378999 6:109547612-109547634 GTGCTACAGGACATTGGTCTGGG + Intronic
1013391967 6:109694505-109694527 ATGCTTCAGGATATTGGTCTAGG + Intronic
1013670387 6:112396050-112396072 GTGTTTTAGGACATTGGTCTGGG - Intergenic
1013763660 6:113549306-113549328 ATGTGTCATGACATTGATCTGGG + Intergenic
1013812801 6:114063755-114063777 ATGTTTGAGGACAATGGCCTTGG + Intronic
1014353266 6:120370977-120370999 AAGTTTCATGACATTAGTCTTGG + Intergenic
1014355260 6:120400530-120400552 ACTTTTCAGGACATTGGTCTGGG - Intergenic
1014697202 6:124638329-124638351 ATGTTTCATGACATAGGTCAAGG + Intronic
1014758948 6:125333965-125333987 AAGTTTCTTGACATTGGTCTTGG - Intergenic
1014862942 6:126492909-126492931 TTATTTCAGGACATTTGTCTGGG - Intergenic
1014934358 6:127369154-127369176 ATGCTTCATGACATTGGACTAGG - Intergenic
1014970006 6:127802254-127802276 ATTTTGCAAGGCATTGGTCAAGG - Intronic
1015069037 6:129066983-129067005 AAGTTCCATGACATTGGTCTGGG + Intronic
1015257239 6:131192162-131192184 ACTCTCCAGGGCATTGGTCTGGG - Intronic
1015285576 6:131483069-131483091 ATGCTTCAAGACATTGGTCTGGG - Intergenic
1015345916 6:132159329-132159351 ATTCTCCAGGACATTGGTCTGGG - Intergenic
1015488844 6:133801785-133801807 ATGCTTCAGGACATTGGTCTGGG - Intergenic
1015597993 6:134884175-134884197 ATGCTTCAGGACATTGATCTGGG + Intergenic
1015668238 6:135656376-135656398 AGGCTTCAGGACATTGGTCTGGG - Intergenic
1016144036 6:140647447-140647469 ATTTTACAAGGCATTGGTCAAGG - Intergenic
1016234304 6:141844206-141844228 ATGTTTCAGGGCATTGGTCTAGG - Intergenic
1016247441 6:142000120-142000142 ACACTTCAGGACATTGGTCTAGG + Intergenic
1016294193 6:142556547-142556569 ATGATTCAGGACATTGTTCTGGG + Intergenic
1016503223 6:144746411-144746433 ATGTTTTAGGGCTTTTCTCTGGG + Intronic
1016642636 6:146366973-146366995 ATATTTCAAGACATTGGTCTCGG - Intronic
1016935240 6:149445035-149445057 CTGTTTCTGGGCATTGGGATAGG + Intergenic
1016955080 6:149618898-149618920 ATGCTTCAGGACATTGGTCTGGG + Intronic
1017143285 6:151211513-151211535 ATACTTCAGGACATTAGTCTAGG + Intergenic
1017509190 6:155097729-155097751 ATGCTTCAGGACATTGGTCTGGG - Intronic
1017935880 6:159004488-159004510 GAGTTTCAGGAGATTGGTCTGGG + Intergenic
1018032861 6:159857001-159857023 ATGCTTCAGGGCATTAGTCTAGG - Intergenic
1018074229 6:160196608-160196630 ATATTTCAGGATATTGGTCTGGG + Intronic
1018263565 6:161995335-161995357 AACATTCAGGACATTGGTCTAGG + Intronic
1018263927 6:161999708-161999730 ATGTTTTGGTGCATTAGTCTTGG - Intronic
1018350064 6:162948457-162948479 ATGCTTCAGGAGATTGGTCTAGG + Intronic
1018517967 6:164608736-164608758 ACACTTCAGGACATTGGTCTAGG + Intergenic
1018562142 6:165111458-165111480 ATGTTTCATGACATTGGTCTGGG - Intergenic
1018917178 6:168141171-168141193 ATTCTCCAGGACATTGGTCTGGG - Intergenic
1019069376 6:169330284-169330306 ACTTTTCTGGACATTGGTCTAGG - Intergenic
1019131042 6:169875106-169875128 ATGGTATAGGACATTGGTCTGGG - Intergenic
1019650254 7:2153104-2153126 ACACTTCAGGACATTGGTCTAGG + Intronic
1020707942 7:11569106-11569128 ATGCTTCAGGACATTGGTCTAGG + Intronic
1020710079 7:11595655-11595677 ATTTTGCAAGGCATTGGTCAAGG - Intronic
1020775481 7:12449307-12449329 ATGCTTCAGGACATTGGTCTGGG + Intergenic
1020970304 7:14929794-14929816 ATTTTTCTGGACATTAGTCTAGG - Intronic
1021033794 7:15771717-15771739 AAGCTTCATGACATTGGTCTGGG + Intergenic
1021065994 7:16173146-16173168 ATTTTTCATTGAATTGGTCTGGG - Intronic
1021124261 7:16832379-16832401 ATGCTCCAGGATATTGGTCTGGG + Intronic
1021192301 7:17635079-17635101 ATGCTTCAGGACATTGGTCTGGG - Intergenic
1021605861 7:22408859-22408881 ATGCTTCAGAACATTGGTCTGGG + Intergenic
1021739801 7:23675152-23675174 ATGCTTCAGGACATTGGTCCAGG - Intergenic
1022085169 7:27060249-27060271 ACACTTCAGGACATTGGTCTGGG + Intergenic
1022223981 7:28344222-28344244 ATGCTTTATGACATTGGTCTTGG - Intronic
1022753279 7:33255220-33255242 AAGCTTCATGGCATTGGTATTGG - Intronic
1022976591 7:35563827-35563849 ATGCTTCTTGACATTGGTCTTGG + Intergenic
1023102160 7:36729089-36729111 ATGCTTCAGGACATTGGTTTGGG - Intergenic
1023218401 7:37891347-37891369 ATGCTTCATAGCATTGGTCTCGG - Intronic
1023347133 7:39282364-39282386 ATGATTCATGACACTGGTCTAGG - Intronic
1023409548 7:39876045-39876067 ATACTTCAAGACATTGGTCTAGG - Intergenic
1023556651 7:41430364-41430386 ATGTTTCAGAGCAGTGGTTAGGG - Intergenic
1023680437 7:42681053-42681075 ATGCTTCAAGACATTTGTCTGGG + Intergenic
1024041037 7:45554633-45554655 AAGTTTCTTGACATTGGTCTTGG + Intergenic
1024127356 7:46313563-46313585 ATGCTTCAGGACATTAATCTAGG - Intergenic
1024177752 7:46858976-46858998 AAGCTTCACGACATTGGTCTTGG + Intergenic
1024199600 7:47092110-47092132 ATACTTCAGGACATTGGTCTAGG + Intergenic
1024285549 7:47754446-47754468 GTGCTTCAGGACATTGGTCGGGG - Intronic
1024424983 7:49215190-49215212 ATTCTCCATGGCATTGGTCTTGG - Intergenic
1024625493 7:51205586-51205608 AAGCTTCATGACATTGGTCTGGG + Intronic
1024680079 7:51677130-51677152 AAGCTTCATGACATTGGTCTCGG + Intergenic
1024898478 7:54288893-54288915 ACCTTTCAGGGTATTAGTCTAGG + Intergenic
1025018143 7:55458001-55458023 ATGTTTCAGGACATAGGTCAAGG - Intronic
1025029325 7:55543983-55544005 ATGCTTCAGGACATTGTTTTGGG - Intronic
1025043387 7:55667979-55668001 ATACTTCAAGACATTGGTCTAGG + Intergenic
1026327707 7:69324983-69325005 ATGTTTCTGGGCCTAGGTCTGGG - Intergenic
1026615856 7:71903621-71903643 AAGCTTCATGACATTGGTCTGGG + Intronic
1027488788 7:78796052-78796074 ATGCTACAGGTCATTGGTCTGGG + Intronic
1027942101 7:84695550-84695572 AATTTCCATGGCATTGGTCTTGG - Intergenic
1028008145 7:85604799-85604821 AGTCTTCAGGACATTGGTCTGGG - Intergenic
1028064880 7:86370891-86370913 AAGCTCCATGGCATTGGTCTGGG + Intergenic
1028260007 7:88652229-88652251 ACTCTTCAGGACATTGGTCTGGG + Intergenic
1028287023 7:89014922-89014944 ATGCTTCAGAACATCGGTCTGGG - Intronic
1028382878 7:90218340-90218362 ATATTTGAAGACATTGGTCTAGG - Intronic
1028403452 7:90449347-90449369 AAGTTTCACGACATTGGTCTGGG - Intronic
1028492763 7:91432164-91432186 ATGCTTCAGGACATTGATCAAGG - Intergenic
1028564259 7:92210601-92210623 ATGCTTTTGGACATTGGTCTAGG + Intronic
1028787445 7:94811732-94811754 ACATTCCAGGACATTGGTCTAGG + Intergenic
1028817896 7:95168461-95168483 ACACTTCAGGACATTGGTCTAGG + Intronic
1029320506 7:99754921-99754943 ACTCTTCAGGACATTGGTCTGGG - Intergenic
1029792268 7:102857151-102857173 ATGCTTCAGGGCATTGATCTTGG + Intronic
1029871422 7:103697113-103697135 ATCTTCCAGTGCCTTGGTCTTGG - Intronic
1030277200 7:107734145-107734167 ATTTTGCAAGGCATTGGTCAAGG - Intergenic
1030294836 7:107912871-107912893 ATGCTCCAGGACACTGGTCTGGG - Intronic
1030382943 7:108834047-108834069 ACATTTCAGGACATTGGTCTGGG - Intergenic
1030476393 7:110038560-110038582 ACTCTTCAGGACATTGGTCTGGG - Intergenic
1030478423 7:110069399-110069421 ATGCTCCAGGGCAATAGTCTGGG - Intergenic
1030759717 7:113335470-113335492 ACGCTTCATGACATTGGTCTGGG - Intergenic
1030802598 7:113870677-113870699 ATATTTCAGGACATTGGTCTAGG + Intergenic
1031071177 7:117163861-117163883 ATGCTTCAGGACATTGGTCTGGG - Intronic
1031189020 7:118522609-118522631 ATGCTTCAGGACGTTGTTCTGGG + Intergenic
1031270092 7:119637458-119637480 AAGTCCCATGGCATTGGTCTGGG - Intergenic
1031304712 7:120112110-120112132 ACGCTTCTGGACATTGGTCTAGG - Intergenic
1031472273 7:122181414-122181436 ATGCTTTAGGACATTGGTGTAGG - Intergenic
1031677310 7:124626305-124626327 AAGTTCCATGGCATTGGTCTGGG + Intergenic
1032104329 7:129013208-129013230 ATGCTGCAGGACATTGATCTGGG + Intronic
1032116264 7:129120157-129120179 ATGCTTCAGGACATGGGTCTGGG - Intergenic
1032318579 7:130863861-130863883 ATGCTACAGGACATTGGTTTGGG + Intergenic
1032822822 7:135540241-135540263 ATGTTCCAGGACATTGGTCTAGG + Intergenic
1033412929 7:141136439-141136461 TTGCTTCAGGACATTGGTCCAGG + Intronic
1033446519 7:141427621-141427643 ATGTTTCATGACATTGGTCTGGG + Intronic
1033579300 7:142717010-142717032 ATGATTCAAGGCAATCGTCTTGG - Intergenic
1033592506 7:142823219-142823241 AAGCTTCATGACATTGGTCTTGG - Intergenic
1033885652 7:145941877-145941899 ATTCTTCAGGACACTGGTCTGGG + Intergenic
1034287201 7:149894313-149894335 ATGCTTTATGACATTGGTCTGGG + Intergenic
1034300253 7:150009117-150009139 ATCTTTTAGGGCTTTGCTCTGGG - Intergenic
1034518086 7:151597343-151597365 ATGCTTCATGACTTTGGTCTGGG + Intronic
1034663923 7:152798599-152798621 ATGCTTTATGACATTGGTCTGGG - Intronic
1034805798 7:154088191-154088213 ATCTTTTAGGGCTTTGCTCTGGG + Intronic
1035550570 8:521003-521025 AAGGTTCAGGGCATTGGATTTGG - Intronic
1036783566 8:11669679-11669701 ATGTTTCATGATGTTGGTCTGGG - Intergenic
1037083948 8:14823148-14823170 ATGCTTCATGACATTGGGCTAGG + Intronic
1037161956 8:15783774-15783796 AAGCTTCATGGCATTGGTCTGGG + Intergenic
1037179490 8:15987762-15987784 ATGTTTCAGGACATTGTTCTAGG - Intergenic
1037282425 8:17256999-17257021 ATGCTTCAGTACATTGTTCTAGG - Intronic
1037377539 8:18248167-18248189 ATGCTTCAGGGCATTCGTTTGGG + Intergenic
1037798986 8:22021307-22021329 ATGCTTCAGGACATGGGTCTAGG + Intergenic
1038225075 8:25648412-25648434 ACACTTCAGGACATTGGTCTGGG - Intergenic
1038352439 8:26789581-26789603 ATGCTTCAGGACATTGGTCTGGG + Intronic
1038414310 8:27382633-27382655 ATCCTTCGGGACATTGGTCTGGG - Intronic
1038875578 8:31545271-31545293 ATGCTTCAGGACATTGGTTTTGG - Intergenic
1039126595 8:34209880-34209902 ATGTATCATAGCATTGATCTGGG - Intergenic
1039173563 8:34778365-34778387 ATGCTTAATGACATTGGTCTGGG + Intergenic
1039330370 8:36530934-36530956 ATTTTGCAGGGCATTGGTCAAGG - Intergenic
1039625292 8:39044162-39044184 AAGCTTCATGACATTGGTCTTGG - Intronic
1039638802 8:39195504-39195526 ATATTTCAGGACATTGTTCTAGG - Intronic
1039647050 8:39298096-39298118 ACTCTTCAGGACATTGGTCTGGG - Intergenic
1039728192 8:40244793-40244815 AATTTTCAGGTCATTGGTATGGG + Intergenic
1039750236 8:40472134-40472156 CTCTCTCAAGGCATTGGTCTTGG + Intergenic
1039964828 8:42276672-42276694 GTGCTTCAGGGCATTGGTCTGGG - Intronic
1040632817 8:49235960-49235982 AATTTCCAGGACATTGGTCTGGG - Intergenic
1040705105 8:50116218-50116240 ATGTTTCAGGGCATGGGGTCTGG - Intronic
1040886775 8:52272123-52272145 AAGTTTCATGGCATTATTCTTGG + Intronic
1040911668 8:52525562-52525584 ATGCTTCAGGACATTGGTCTGGG - Intergenic
1040973095 8:53158893-53158915 ATGCTTCAGGACACTGGTCTGGG - Intergenic
1041078961 8:54196605-54196627 ATGCTCCAGGACATTGGTCTTGG - Intergenic
1041509408 8:58638694-58638716 AAGCTTCTCGGCATTGGTCTGGG + Intronic
1041677981 8:60555284-60555306 ATGCTTCAGGACATTGGTCAAGG + Intronic
1042002627 8:64143125-64143147 ATGCTTCAAGACATTGGTCCGGG + Intergenic
1042130274 8:65580956-65580978 ACTTTTCTGGACATTGGTCTAGG + Intergenic
1042273468 8:66979126-66979148 ATGCTTCAGGACATTGGTCTGGG - Intronic
1042634531 8:70858923-70858945 ATGTTCCAGGACCTTTGTCTGGG + Intergenic
1042917191 8:73887082-73887104 CTGCTTCAGAACATTGGTCTGGG + Intergenic
1042919290 8:73906543-73906565 ATGTTGCAATGCAATGGTCTGGG + Intergenic
1042930713 8:74011301-74011323 ATTCTTCTGGACATTGGTCTAGG + Intronic
1043110711 8:76177306-76177328 ATGCTTCAAGACATTGGTCAAGG - Intergenic
1043144076 8:76629717-76629739 ATGCTTCAGGACATTGGTCTGGG + Intergenic
1043233104 8:77827462-77827484 ATGCTTCAGGACATTGATGTGGG - Intergenic
1043569380 8:81585154-81585176 ATGCTCCAAGACATTGGTCTTGG - Intergenic
1043657642 8:82690347-82690369 ATGCTCCAGGACATTGGTCTGGG + Intergenic
1043674259 8:82930529-82930551 AAGCTTCATGCCATTGGTCTGGG - Intergenic
1043733685 8:83717817-83717839 ATTTTGCAAGGCATTGGTCAAGG - Intergenic
1043809602 8:84720557-84720579 ATGCCTTATGGCATTGGTCTGGG + Intronic
1043840801 8:85101618-85101640 ATATTTCAGAACATTTGTCTAGG - Intergenic
1044047054 8:87449125-87449147 ATGTTTTAAGTCATTGGTCTCGG + Intronic
1044150549 8:88771105-88771127 ATTTTGCAAGGCATTGGTCAAGG - Intergenic
1044381449 8:91538788-91538810 ATGTTACATGACATAGGTCTGGG - Intergenic
1044431785 8:92116065-92116087 ATGCTACAGGGCATTGGTCTAGG - Intergenic
1044505225 8:93008897-93008919 ATGATTCATGACATTGGACTAGG + Intronic
1044809940 8:96049557-96049579 ACTTTTCAGGACATTGGTCTAGG + Intergenic
1044889741 8:96821361-96821383 ATGTCCCAGAACATTGGTCTGGG - Intronic
1045337394 8:101220124-101220146 ATGCTTTAGGAAATTGGTCTGGG + Intergenic
1045515722 8:102859426-102859448 ATGTTTCACATCATTGCTCTTGG - Intronic
1045606144 8:103779318-103779340 ATGTTCCAGGACATAGATCTGGG - Intronic
1046022654 8:108684649-108684671 ATGCTTCAAGATATTGGTCTGGG - Intronic
1046120916 8:109845872-109845894 ATGTTTCAGGACAACGGTATAGG - Intergenic
1046197317 8:110882285-110882307 ATTTTACAAGGCATTGGTCAAGG - Intergenic
1046267419 8:111848350-111848372 ATGTTTCACAACATTGGACTGGG - Intergenic
1046335864 8:112786339-112786361 AACTCTCAGGACATTGGTCTGGG + Intronic
1047676621 8:127209533-127209555 AAGTTTCAGGGCAGTGGTTGAGG + Intergenic
1047900812 8:129420623-129420645 ATGTTTCAGGGCATGGGTTCAGG + Intergenic
1048515002 8:135098528-135098550 ATATTTCATGACATTGATCTGGG - Intergenic
1048585898 8:135773594-135773616 ATGCTTCAAGGCATTGGTCTGGG - Intergenic
1048891109 8:138948040-138948062 ATGTTTCACAACATTGGACTGGG + Intergenic
1049287803 8:141785980-141786002 ATGTGTCAGGACATTGGTAGAGG + Intergenic
1049489934 8:142891198-142891220 ACTTTCCAGGACATTGGTCTGGG - Intronic
1049848130 8:144814588-144814610 ATGCTTCAGGACACTGGTCTGGG + Intergenic
1049953146 9:665239-665261 ATGCTCCAGGACATTGGTCTGGG - Intronic
1050084991 9:1955606-1955628 ATGCTGCATGGCATTGGTCTAGG + Intergenic
1050579416 9:7035558-7035580 ACACTTCAGGACATTGGTCTGGG - Intronic
1050690075 9:8217178-8217200 ATGCTCCATGACATTGGTCTGGG - Intergenic
1050841998 9:10161614-10161636 ATGCTTCAGGGCAATGGTTTGGG + Intronic
1050948264 9:11553337-11553359 AAGCTTCATGACATTGGTCTTGG - Intergenic
1051197817 9:14582530-14582552 ATGCTTCAGGACACTGGCCTAGG + Intergenic
1051718797 9:20013480-20013502 ATGCTTCATGACATTGGTCTGGG + Intergenic
1051908301 9:22122469-22122491 ATGCTTCAGGACCTTGGTCTGGG - Intergenic
1052053721 9:23880470-23880492 ATGCCTCAGGACATTGTTCTGGG - Intergenic
1052094871 9:24371349-24371371 ATGCTCCAGGACATTGGACTAGG + Intergenic
1052127452 9:24795050-24795072 AAGTTTCATGATATTGGTCTTGG + Intergenic
1052142782 9:25007781-25007803 ATGCTTCATGACATAGGTCTTGG + Intergenic
1052152743 9:25139210-25139232 ATGCTTCAGGATATTGGTCTAGG + Intergenic
1052262442 9:26532985-26533007 ATGTTTCATGACATTGATCTGGG + Intergenic
1052394348 9:27920701-27920723 AATTTTCTGGACATTGGTCTAGG + Intergenic
1052539253 9:29786819-29786841 AATCTTCAGGACATTGGTCTGGG + Intergenic
1052594306 9:30538823-30538845 ATGCTTCAGGACATTGGTCTAGG - Intergenic
1052628774 9:31009810-31009832 ACCTTTCAGGGCATAGGTATGGG + Intergenic
1052681214 9:31695343-31695365 ACCCTTCAGGGCATTGCTCTAGG + Intergenic
1052686149 9:31759057-31759079 ATGCTTCAGAACATTGATCTAGG - Intergenic
1052690077 9:31806664-31806686 ATAATTCAAGACATTGGTCTGGG + Intergenic
1052714210 9:32095693-32095715 ATTCTTCAGGACATTGGACTGGG - Intergenic
1053590480 9:39509432-39509454 ATTCTTCTGGACATTGGTCTAGG + Intergenic
1053694561 9:40624120-40624142 ATGCTCCAGGACATTAGTCTGGG - Intergenic
1053695124 9:40631552-40631574 ATCCTTCAGGACATTGCTCTGGG + Intergenic
1053724341 9:40982930-40982952 ATGTTATATGTCATTGGTCTGGG + Intergenic
1053848340 9:42264830-42264852 ATTCTTCTGGACATTGGTCTAGG + Intergenic
1053941553 9:43254489-43254511 ATGCTCCAGGACATTAGTCTGGG - Intergenic
1053942113 9:43261940-43261962 ATCCTTCAGGACATTGCTCTGGG + Intergenic
1054269718 9:63008564-63008586 ATCCTTCAGGACATTGCTCTGGG - Intergenic
1054270274 9:63015997-63016019 ATGCTCCAGGACATTAGTCTGGG + Intergenic
1054305806 9:63423342-63423364 ATGCTCCAGGACATTAGTCTGGG - Intergenic
1054306368 9:63430777-63430799 ATCCTTCAGGACATTGCTCTGGG + Intergenic
1054341627 9:63869069-63869091 ATGTTATATGTCATTGGTCTGGG - Intergenic
1054404553 9:64747328-64747350 ATGCTCCAGGACATTAGTCTGGG - Intergenic
1054405109 9:64754767-64754789 ATCCTTCAGGACATTGCTCTGGG + Intergenic
1054438175 9:65232815-65232837 ATGCTCCAGGACATTAGTCTGGG - Intergenic
1054438735 9:65240259-65240281 ATCCTTCAGGACATTGCTCTGGG + Intergenic
1054491669 9:65781687-65781709 ATCCTTCAGGACATTGCTCTGGG - Intergenic
1054492229 9:65789126-65789148 ATGCTCCAGGACATTAGTCTGGG + Intergenic
1054575823 9:66855857-66855879 ATTCTTCTGGACATTGGTCTAGG - Intergenic
1055345562 9:75333422-75333444 ATGCTTCAGAACATTTGTCTGGG + Intergenic
1055684758 9:78759682-78759704 ATGTGTCAGTACATTGGTCTAGG + Intergenic
1055866630 9:80821929-80821951 ATTTTGCAGGGCACTGGTTTAGG - Intergenic
1055908752 9:81323344-81323366 ATGCTTCAGGACATTGGGCAAGG - Intergenic
1056087795 9:83170000-83170022 CCATTTCAGGACATTGGTCTGGG - Intergenic
1056171481 9:83989255-83989277 ATGCTTCAGGACATTGTTCTGGG + Intronic
1056288519 9:85116052-85116074 ATGCTTCAAGACATTGATCTGGG - Intergenic
1056344408 9:85676122-85676144 ATGCTTCCGGATATTGGTCTGGG + Intronic
1056366773 9:85912871-85912893 ATGTCTTATGGCACTGGTCTGGG - Intergenic
1056415428 9:86371054-86371076 ATGCTTCAGGACATTGGTCTGGG - Intergenic
1056593206 9:87981415-87981437 GTGCTTCAGGATATTGGTCTGGG + Intergenic
1056952411 9:91053123-91053145 AAGCTCCATGGCATTGGTCTTGG + Intergenic
1057295692 9:93837698-93837720 CTGCTCCAGGACATTGGTCTGGG - Intergenic
1058129922 9:101239968-101239990 ATGTTTTAGGACATTGGTCTAGG - Intronic
1058144323 9:101394716-101394738 ATGCTTCAGGACATTGGTCTGGG + Intronic
1058144334 9:101394848-101394870 ATGCTTCAGGACTTTGGTCTGGG + Intronic
1058168251 9:101646145-101646167 ATGCTTCAGGACATTGGTCTTGG - Intronic
1058201445 9:102047006-102047028 ATGCTTCAAGACATTGGTCTGGG - Intergenic
1058269814 9:102957390-102957412 AAGTTTCATGACATTGGTTTTGG - Intergenic
1058302468 9:103393140-103393162 ACTCTTCAGGACATTGGTCTAGG - Intergenic
1058444994 9:105046951-105046973 CTGCTGCAGGGCATTAGTCTTGG - Intergenic
1059066046 9:111085251-111085273 ATGCTTCAGGACGCTGGTCTGGG - Intergenic
1060079659 9:120631051-120631073 ATGTTTCAGGGCAGTGCTCTGGG - Intronic
1060128031 9:121069067-121069089 ATGGTTCCGGACACTGGTCTAGG + Intergenic
1060164325 9:121397301-121397323 ATGCTTCAGGACATTGCTCTGGG - Intergenic
1060324475 9:122599625-122599647 ACACTTCAGGACATTGGTCTGGG - Intergenic
1061749458 9:132767048-132767070 ACACTTCAGGACATTGGTCTGGG + Intronic
1061956628 9:133966200-133966222 ATGCTTCCGGACATTGGTCTGGG + Intronic
1202777566 9_KI270717v1_random:5170-5192 ATCCTTCAGGACATTGCTCTGGG + Intergenic
1203450453 Un_GL000219v1:109033-109055 ATGTTATATGTCATTGGTCTGGG - Intergenic
1185748043 X:2587309-2587331 ATGCTTCAGGACCTTGGTCTAGG + Intergenic
1186298501 X:8174209-8174231 ATGCTCCAGGACATTGGTCTGGG - Intergenic
1186535422 X:10342122-10342144 ATTTTTCTGGGCATTAGTTTAGG - Intergenic
1186657062 X:11624293-11624315 ATGCTTCAGGACACTGGTCTGGG + Intronic
1186937297 X:14464254-14464276 ATGCTCCAGGATATTGGTCTGGG - Intergenic
1186962855 X:14756240-14756262 ATGTATCATGACACTGGTCTGGG + Intergenic
1187305585 X:18092607-18092629 ATGCTTCAGGACATTGGTCTGGG - Intergenic
1187620872 X:21053061-21053083 AAGTTTCATGACATTGATCTAGG + Intergenic
1187633390 X:21200240-21200262 AAGCTTCATGTCATTGGTCTGGG + Intergenic
1187660055 X:21534952-21534974 ATACTTCAGGACATTGGTCTAGG - Intronic
1187782316 X:22841320-22841342 ATATTTCAGGACACTGGTCTAGG + Intergenic
1188045172 X:25417473-25417495 ATTCTCCAGGACATTGGTCTGGG - Intergenic
1188064548 X:25642508-25642530 ATGCTCTAGGACATTGGTCTGGG - Intergenic
1188087032 X:25912112-25912134 ATTCTTCATGACATTGGTCTTGG - Intergenic
1188714126 X:33439990-33440012 AGGTGTCAAGCCATTGGTCTTGG + Intergenic
1188739206 X:33756403-33756425 ATACTTCAGGACATTGGTCTAGG - Intergenic
1188745998 X:33844534-33844556 ATGCTTCACAACATTGGTCTGGG - Intergenic
1188773693 X:34186973-34186995 ATTCTCCAGGACATTGGTCTGGG - Intergenic
1188788200 X:34374924-34374946 AATCTCCAGGGCATTGGTCTGGG + Intergenic
1188902978 X:35758001-35758023 ATGCTCCAGGATATTGGTCTGGG - Intergenic
1188990298 X:36810653-36810675 AAGTTTCTTGACATTGGTCTTGG + Intergenic
1189422566 X:40869457-40869479 ATGGTTCAGGGTGTGGGTCTGGG - Intergenic
1189454999 X:41178783-41178805 ATGTTTCATGTCATTAGTGTGGG - Intronic
1189612596 X:42753000-42753022 ATTTCTCGGGGCATTGGGCTGGG + Intergenic
1189873786 X:45412844-45412866 AATCTTCAGGACATTGGTCTGGG - Intergenic
1189888356 X:45573394-45573416 ATGCTTCAGGACATGGGTTTAGG - Intergenic
1189951123 X:46232105-46232127 ATATTTCAGGACATTGGTCTAGG + Intergenic
1190464658 X:50713888-50713910 ACTCTTCAGGACATTGGTCTGGG - Intronic
1190507557 X:51141473-51141495 ATGCTTCAGGACACTGGCCTGGG - Intergenic
1190513660 X:51200530-51200552 ATCCTTCAGAACATTGGTCTGGG + Intergenic
1190585656 X:51938095-51938117 ATGCTTCAGGACATTGGTCTTGG + Intergenic
1190621361 X:52289639-52289661 ATGCTTCAAGACATTGGTCTGGG - Intergenic
1190820799 X:53970044-53970066 ATGCTATAGGACATTGGTCTGGG + Intronic
1190837333 X:54113127-54113149 ACTGTTCAGGACATTGGTCTAGG + Intronic
1190876576 X:54464542-54464564 ATGTTTTTGTGCATTGTTCTAGG - Intronic
1190922250 X:54865073-54865095 AAGCTTCATGACATTGGTCTGGG - Intergenic
1191131458 X:57016286-57016308 ACATTTCAGGACATTGGTATAGG - Intergenic
1191201606 X:57788718-57788740 ATTTCCCAGGACATTGGTCTTGG + Intergenic
1191598692 X:62976971-62976993 ACACTTCAGGACATTGGTCTTGG - Intergenic
1191659061 X:63631950-63631972 ATTTTGCAAGGCATTGGTCAAGG + Intergenic
1191694308 X:63973580-63973602 ATTCTTCTGGACATTGGTCTAGG + Intergenic
1191830528 X:65410382-65410404 ATTCTCCAGGACATTGGTCTAGG + Intronic
1191926996 X:66323799-66323821 AACTTCCAGGGCATAGGTCTGGG + Intergenic
1191930121 X:66363172-66363194 ACACTTTAGGGCATTGGTCTAGG - Intergenic
1191994984 X:67084235-67084257 GTGCTTCAGGACTTTGGTCTAGG - Intergenic
1192012019 X:67284073-67284095 AAGCTTCAGGGGATTGGTCCAGG + Intergenic
1192324580 X:70121993-70122015 ATTTTTCATGTCATTGGTCATGG + Intergenic
1192326726 X:70138993-70139015 ATGTTCCACTGCATTTGTCTTGG + Intronic
1192395342 X:70775258-70775280 ATGCTTCAGGACATTGGTCTAGG + Intronic
1192626688 X:72736085-72736107 ATTCTTCTGGACATTGGTCTGGG - Intergenic
1192671347 X:73145372-73145394 AATCTTCAGGACATTGGTCTGGG - Intergenic
1192679768 X:73240110-73240132 AAACTTCTGGGCATTGGTCTTGG - Intergenic
1192716345 X:73646872-73646894 ATGCTTCAAGGTATTGGTCTGGG - Intronic
1193022960 X:76812243-76812265 AACCTTCAAGGCATTGGTCTTGG + Intergenic
1193072918 X:77325392-77325414 ATGCTTCAGGTAATTGGTCTAGG + Intergenic
1193155891 X:78173987-78174009 ATTTTGCAAGGCATTGGTCAAGG + Intergenic
1193167341 X:78295971-78295993 ATGCTCCAGGACATTGTTCTGGG - Intronic
1193172410 X:78350557-78350579 ATGCTTCACATCATTGGTCTGGG - Intergenic
1193204430 X:78731052-78731074 ATCCCTCAGGACATTGGTCTGGG - Intergenic
1193224024 X:78960529-78960551 ATGTTTCAGTGTATTTGTCAAGG - Exonic
1193309952 X:79994832-79994854 ATGCTTCAGGACATTGGTCTTGG + Intergenic
1193321863 X:80132220-80132242 ATACTTCAGGGCATCGGTCTGGG - Intergenic
1193433147 X:81437379-81437401 ATTTTGCAGAGCATTGGTCAAGG + Intergenic
1193481034 X:82029488-82029510 ACACTTCAGGACATTGGTCTAGG + Intergenic
1193496715 X:82221334-82221356 ATGTTTCATGACATTGGAGTGGG - Intergenic
1193516271 X:82468721-82468743 ATGTTCCATGACATTGGTCTGGG - Intergenic
1193657381 X:84214819-84214841 ATGTTTCATAACATTGGCCTTGG + Intergenic
1193693249 X:84674188-84674210 AATTTCCAGGACATTGGTCTGGG + Intergenic
1193704189 X:84801145-84801167 ATACTACAGGACATTGGTCTGGG - Intergenic
1193883509 X:86956623-86956645 ATGCTTCAAGACATTGGTCAGGG - Intergenic
1193931647 X:87561069-87561091 CTGATTCAGGACATTGGTGTTGG + Intronic
1194093703 X:89609325-89609347 ATGTTTCAGGACATTTGTGTGGG + Intergenic
1194247147 X:91529605-91529627 ACTCTTCAGGACATTGGTCTGGG - Intergenic
1194287763 X:92031555-92031577 ATGCTCCAGGACATTGGTCTGGG - Intronic
1194300974 X:92185428-92185450 ATGCTTCAGAACATTGATCTGGG + Intronic
1194421786 X:93684075-93684097 ATGCTTCAGGACACTGGTTTGGG - Intronic
1194472480 X:94314442-94314464 ATGCTTCACAACATTGGTCTTGG - Intergenic
1194611788 X:96053574-96053596 ATTTTCCAGGACATTGGTCTGGG - Intergenic
1194800892 X:98270965-98270987 ATACTTCAGGACATTGATCTAGG + Intergenic
1194806875 X:98340248-98340270 ACACTTCAGGACATTGGTCTGGG - Intergenic
1194833687 X:98656833-98656855 ATTTTGCAGGGCAATGGTCAAGG - Intergenic
1195484193 X:105384182-105384204 ATGCTTCAGGACATTGGTCTGGG - Intronic
1195612128 X:106879611-106879633 ATGTTTCATGACATTGGTTTGGG + Intronic
1195632518 X:107073061-107073083 ACATTTCAGGACACTGGTCTGGG + Intronic
1195730481 X:107961854-107961876 ACTGTTCAGGACATTGGTCTGGG - Intergenic
1195744482 X:108102614-108102636 AAGCATCATGGCATTGGTCTTGG - Intronic
1195749099 X:108146638-108146660 ATTTTGCAAGGCATTGGTCAAGG + Intronic
1195832989 X:109080734-109080756 ATTCTACAGGACATTGGTCTCGG + Intergenic
1196205879 X:112938776-112938798 AAGCTCCAGGACATTGGTCTGGG + Intergenic
1196320387 X:114333293-114333315 AAGATTCTTGGCATTGGTCTAGG - Intergenic
1196475817 X:116084179-116084201 ATTCTTCTGGACATTGGTCTAGG + Intergenic
1196538546 X:116877459-116877481 AATCTCCAGGGCATTGGTCTGGG - Intergenic
1196569699 X:117250970-117250992 AAGCTCCATGGCATTGGTCTAGG - Intergenic
1196592431 X:117502387-117502409 ATGCTTCATGACATTGGACTAGG + Intergenic
1196620607 X:117819385-117819407 ACATTTCAGAACATTGGTCTGGG + Intergenic
1196883128 X:120218005-120218027 ATGCTTCAAGACATTGGTCTTGG + Intergenic
1197011893 X:121574087-121574109 ATGCTTCAGGACATTGGTCTGGG + Intergenic
1197020286 X:121679080-121679102 ATGCTTCAAGACATTGGTCTGGG + Intergenic
1197073650 X:122329983-122330005 ATTTTTCTGGACATTGGTCTAGG + Intergenic
1197096498 X:122602999-122603021 ATGTTCCAGGACATTGGTCTTGG + Intergenic
1197105546 X:122709759-122709781 ATGTTTCAGGACATTGGTCTGGG + Intergenic
1197408309 X:126083456-126083478 ATGTTTCAGGACATTGGACTGGG - Intergenic
1197468855 X:126841485-126841507 AATCTTCAGGACATTGGTCTGGG + Intergenic
1197494651 X:127162819-127162841 ACATTTCAGGACATTGGTGTAGG - Intergenic
1197497174 X:127198795-127198817 ATGCTTTGGGACATTGGTCTAGG + Intergenic
1197595624 X:128460466-128460488 ATGTTTCAGAGCACTGAACTAGG + Intergenic
1197892645 X:131281596-131281618 ATCTTTCTGGGCACTGATCTGGG + Intronic
1198007461 X:132511379-132511401 ATTTTTCAGGACATTGGTGTAGG + Intergenic
1198171623 X:134111703-134111725 ATGCTTCGGGACCTTGGTCTGGG - Intergenic
1198188909 X:134284408-134284430 ATGCTTCAAGACATTGGTCTGGG - Intergenic
1198190955 X:134305167-134305189 ATGCTCCAGGACATTGGTCTGGG + Intergenic
1198192626 X:134325027-134325049 ATACTTCAGGATATTGGTCTAGG - Intergenic
1198547994 X:137713714-137713736 ATACTTCAGGACATTGGTCTAGG - Intergenic
1198550441 X:137739773-137739795 ATACTTCAGGACATTGGTCTAGG - Intergenic
1198634931 X:138687069-138687091 ATGCTACAGGACATTGGTCTTGG + Intronic
1198860404 X:141062816-141062838 ACGCTTCAGGACATTGGTCTAGG + Intergenic
1198902287 X:141524574-141524596 ACGCTTCAGGACATTGGTCTAGG - Intergenic
1199163568 X:144643963-144643985 ATGCTTCAGGACATTGATCAGGG + Intergenic
1199164094 X:144649347-144649369 ATGTTCCAGGACTTTGGTCTAGG + Intergenic
1199244739 X:145590254-145590276 ATGCTTCAAGACATTGGTCTAGG + Intergenic
1199732575 X:150650944-150650966 CTGTTTCTGGGCCTTTGTCTAGG + Intronic
1199790457 X:151150031-151150053 ATACTTCAGGACATTGGTCTGGG - Intergenic
1200021400 X:153213302-153213324 ATGCTTGAGGACACTGGTCTGGG - Intergenic
1200295139 X:154912274-154912296 ATGCTCCAGGACATTGGTCTGGG - Intronic
1200298413 X:154946642-154946664 ATGCGCCAGGACATTGGTCTGGG + Intronic
1200328801 X:155272444-155272466 ACATACCAGGGCATTGGTCTGGG - Intergenic
1200340549 X:155391050-155391072 ATTTCTCAAGGCATTGGTCAAGG + Intergenic
1200406956 Y:2821885-2821907 ACTCTCCAGGGCATTGGTCTAGG - Intergenic
1200446333 Y:3265453-3265475 ATGTTTCAGGACATTTGTGTGGG + Intergenic
1200521045 Y:4210081-4210103 ATTTTGCAAGGCATTGGTCAAGG - Intergenic
1200566169 Y:4771143-4771165 ACTCTTCAGGACATTGGTCTGGG - Intergenic
1200605294 Y:5256115-5256137 ATGCTCCAGGACATTGGTCTGGG - Intronic
1201192368 Y:11456021-11456043 ATGATCCAGGACATTAGTCTGGG - Intergenic
1201192912 Y:11463456-11463478 ATCCTTCAGGACATTGCTCTGGG + Intergenic
1201439192 Y:13990045-13990067 ATGCTCCAGGACATTGGTCTGGG - Intergenic
1201445381 Y:14052663-14052685 ATGCTCCAGGACATTGGTCTGGG + Intergenic
1201941377 Y:19463848-19463870 ATGCTTCAGGACATTGGTCTAGG + Intergenic
1201948064 Y:19533676-19533698 ACGCTTCAGGGCATTCATCTAGG + Intergenic
1202051619 Y:20787351-20787373 ATGTTCCAGGACATTGGTCTGGG - Intergenic