ID: 1016239158

View in Genome Browser
Species Human (GRCh38)
Location 6:141908313-141908335
Sequence CTGCCTTTCAGCTGCTACTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016239158_1016239159 8 Left 1016239158 6:141908313-141908335 CCAGAGTAGCAGCTGAAAGGCAG No data
Right 1016239159 6:141908344-141908366 TCATATTTATACCTACTTTTAGG No data
1016239158_1016239161 24 Left 1016239158 6:141908313-141908335 CCAGAGTAGCAGCTGAAAGGCAG No data
Right 1016239161 6:141908360-141908382 TTTTAGGTGCATGCAAACTAAGG No data
1016239158_1016239162 25 Left 1016239158 6:141908313-141908335 CCAGAGTAGCAGCTGAAAGGCAG No data
Right 1016239162 6:141908361-141908383 TTTAGGTGCATGCAAACTAAGGG No data
1016239158_1016239163 26 Left 1016239158 6:141908313-141908335 CCAGAGTAGCAGCTGAAAGGCAG No data
Right 1016239163 6:141908362-141908384 TTAGGTGCATGCAAACTAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016239158 Original CRISPR CTGCCTTTCAGCTGCTACTC TGG (reversed) Intergenic
No off target data available for this crispr