ID: 1016241718

View in Genome Browser
Species Human (GRCh38)
Location 6:141939171-141939193
Sequence CCAGGAAATAAGTAAAAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016241714_1016241718 24 Left 1016241714 6:141939124-141939146 CCATCAACTATGTAAAATTACAG No data
Right 1016241718 6:141939171-141939193 CCAGGAAATAAGTAAAAAGCAGG No data
1016241713_1016241718 28 Left 1016241713 6:141939120-141939142 CCAACCATCAACTATGTAAAATT No data
Right 1016241718 6:141939171-141939193 CCAGGAAATAAGTAAAAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016241718 Original CRISPR CCAGGAAATAAGTAAAAAGC AGG Intergenic
No off target data available for this crispr