ID: 1016245131

View in Genome Browser
Species Human (GRCh38)
Location 6:141971282-141971304
Sequence GTCTGATGGGCTTCCCTTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016245131_1016245139 26 Left 1016245131 6:141971282-141971304 CCTCAAAGGGAAGCCCATCAGAC No data
Right 1016245139 6:141971331-141971353 CTACAAGGCAGAAGAGAGTGGGG No data
1016245131_1016245136 11 Left 1016245131 6:141971282-141971304 CCTCAAAGGGAAGCCCATCAGAC No data
Right 1016245136 6:141971316-141971338 CTCTCGGCAGAAACTCTACAAGG No data
1016245131_1016245138 25 Left 1016245131 6:141971282-141971304 CCTCAAAGGGAAGCCCATCAGAC No data
Right 1016245138 6:141971330-141971352 TCTACAAGGCAGAAGAGAGTGGG No data
1016245131_1016245137 24 Left 1016245131 6:141971282-141971304 CCTCAAAGGGAAGCCCATCAGAC No data
Right 1016245137 6:141971329-141971351 CTCTACAAGGCAGAAGAGAGTGG No data
1016245131_1016245140 27 Left 1016245131 6:141971282-141971304 CCTCAAAGGGAAGCCCATCAGAC No data
Right 1016245140 6:141971332-141971354 TACAAGGCAGAAGAGAGTGGGGG No data
1016245131_1016245135 -5 Left 1016245131 6:141971282-141971304 CCTCAAAGGGAAGCCCATCAGAC No data
Right 1016245135 6:141971300-141971322 CAGACTAACAGCGGATCTCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016245131 Original CRISPR GTCTGATGGGCTTCCCTTTG AGG (reversed) Intergenic