ID: 1016245134

View in Genome Browser
Species Human (GRCh38)
Location 6:141971296-141971318
Sequence GAGATCCGCTGTTAGTCTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016245134_1016245136 -3 Left 1016245134 6:141971296-141971318 CCATCAGACTAACAGCGGATCTC No data
Right 1016245136 6:141971316-141971338 CTCTCGGCAGAAACTCTACAAGG No data
1016245134_1016245137 10 Left 1016245134 6:141971296-141971318 CCATCAGACTAACAGCGGATCTC No data
Right 1016245137 6:141971329-141971351 CTCTACAAGGCAGAAGAGAGTGG No data
1016245134_1016245140 13 Left 1016245134 6:141971296-141971318 CCATCAGACTAACAGCGGATCTC No data
Right 1016245140 6:141971332-141971354 TACAAGGCAGAAGAGAGTGGGGG No data
1016245134_1016245139 12 Left 1016245134 6:141971296-141971318 CCATCAGACTAACAGCGGATCTC No data
Right 1016245139 6:141971331-141971353 CTACAAGGCAGAAGAGAGTGGGG No data
1016245134_1016245138 11 Left 1016245134 6:141971296-141971318 CCATCAGACTAACAGCGGATCTC No data
Right 1016245138 6:141971330-141971352 TCTACAAGGCAGAAGAGAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016245134 Original CRISPR GAGATCCGCTGTTAGTCTGA TGG (reversed) Intergenic