ID: 1016245136

View in Genome Browser
Species Human (GRCh38)
Location 6:141971316-141971338
Sequence CTCTCGGCAGAAACTCTACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016245131_1016245136 11 Left 1016245131 6:141971282-141971304 CCTCAAAGGGAAGCCCATCAGAC No data
Right 1016245136 6:141971316-141971338 CTCTCGGCAGAAACTCTACAAGG No data
1016245134_1016245136 -3 Left 1016245134 6:141971296-141971318 CCATCAGACTAACAGCGGATCTC No data
Right 1016245136 6:141971316-141971338 CTCTCGGCAGAAACTCTACAAGG No data
1016245133_1016245136 -2 Left 1016245133 6:141971295-141971317 CCCATCAGACTAACAGCGGATCT No data
Right 1016245136 6:141971316-141971338 CTCTCGGCAGAAACTCTACAAGG No data
1016245130_1016245136 12 Left 1016245130 6:141971281-141971303 CCCTCAAAGGGAAGCCCATCAGA No data
Right 1016245136 6:141971316-141971338 CTCTCGGCAGAAACTCTACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016245136 Original CRISPR CTCTCGGCAGAAACTCTACA AGG Intergenic