ID: 1016249471

View in Genome Browser
Species Human (GRCh38)
Location 6:142022386-142022408
Sequence CCAGTTCCTGCAGTTAGTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016249468_1016249471 -9 Left 1016249468 6:142022372-142022394 CCAAATTTTGATACCCAGTTCCT No data
Right 1016249471 6:142022386-142022408 CCAGTTCCTGCAGTTAGTTGAGG No data
1016249466_1016249471 27 Left 1016249466 6:142022336-142022358 CCTGAAATTATGACATAACAAGT No data
Right 1016249471 6:142022386-142022408 CCAGTTCCTGCAGTTAGTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016249471 Original CRISPR CCAGTTCCTGCAGTTAGTTG AGG Intergenic
No off target data available for this crispr