ID: 1016251333

View in Genome Browser
Species Human (GRCh38)
Location 6:142046906-142046928
Sequence GATCCATTGTTAAGTGTATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016251329_1016251333 -1 Left 1016251329 6:142046884-142046906 CCTAGTATAAATCCCCAACTCTG No data
Right 1016251333 6:142046906-142046928 GATCCATTGTTAAGTGTATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016251333 Original CRISPR GATCCATTGTTAAGTGTATC TGG Intergenic
No off target data available for this crispr