ID: 1016256701

View in Genome Browser
Species Human (GRCh38)
Location 6:142115254-142115276
Sequence TAAAATCCTATTTATTTTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016256701_1016256708 6 Left 1016256701 6:142115254-142115276 CCTAAAAAATAAATAGGATTTTA No data
Right 1016256708 6:142115283-142115305 AAGATGGAGAGTATAGTGGGAGG No data
1016256701_1016256706 2 Left 1016256701 6:142115254-142115276 CCTAAAAAATAAATAGGATTTTA No data
Right 1016256706 6:142115279-142115301 GGGGAAGATGGAGAGTATAGTGG No data
1016256701_1016256705 -10 Left 1016256701 6:142115254-142115276 CCTAAAAAATAAATAGGATTTTA No data
Right 1016256705 6:142115267-142115289 TAGGATTTTAATGGGGAAGATGG No data
1016256701_1016256709 7 Left 1016256701 6:142115254-142115276 CCTAAAAAATAAATAGGATTTTA No data
Right 1016256709 6:142115284-142115306 AGATGGAGAGTATAGTGGGAGGG No data
1016256701_1016256707 3 Left 1016256701 6:142115254-142115276 CCTAAAAAATAAATAGGATTTTA No data
Right 1016256707 6:142115280-142115302 GGGAAGATGGAGAGTATAGTGGG No data
1016256701_1016256710 16 Left 1016256701 6:142115254-142115276 CCTAAAAAATAAATAGGATTTTA No data
Right 1016256710 6:142115293-142115315 GTATAGTGGGAGGGTAAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016256701 Original CRISPR TAAAATCCTATTTATTTTTT AGG (reversed) Intergenic
No off target data available for this crispr