ID: 1016256709

View in Genome Browser
Species Human (GRCh38)
Location 6:142115284-142115306
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016256701_1016256709 7 Left 1016256701 6:142115254-142115276 CCTAAAAAATAAATAGGATTTTA No data
Right 1016256709 6:142115284-142115306 AGATGGAGAGTATAGTGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016256709 Original CRISPR AGATGGAGAGTATAGTGGGA GGG Intergenic
No off target data available for this crispr