ID: 1016257003

View in Genome Browser
Species Human (GRCh38)
Location 6:142119288-142119310
Sequence TCATATGTCCCATCCTGGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016257003_1016257013 20 Left 1016257003 6:142119288-142119310 CCACACCAGGATGGGACATATGA No data
Right 1016257013 6:142119331-142119353 CTAAATAGGACCATATCATTAGG No data
1016257003_1016257014 25 Left 1016257003 6:142119288-142119310 CCACACCAGGATGGGACATATGA No data
Right 1016257014 6:142119336-142119358 TAGGACCATATCATTAGGCTTGG No data
1016257003_1016257008 6 Left 1016257003 6:142119288-142119310 CCACACCAGGATGGGACATATGA No data
Right 1016257008 6:142119317-142119339 CAGGATACCCCCATCTAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016257003 Original CRISPR TCATATGTCCCATCCTGGTG TGG (reversed) Intergenic
No off target data available for this crispr