ID: 1016257005

View in Genome Browser
Species Human (GRCh38)
Location 6:142119293-142119315
Sequence CCCAGTCATATGTCCCATCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016257005_1016257008 1 Left 1016257005 6:142119293-142119315 CCAGGATGGGACATATGACTGGG No data
Right 1016257008 6:142119317-142119339 CAGGATACCCCCATCTAAATAGG No data
1016257005_1016257014 20 Left 1016257005 6:142119293-142119315 CCAGGATGGGACATATGACTGGG No data
Right 1016257014 6:142119336-142119358 TAGGACCATATCATTAGGCTTGG No data
1016257005_1016257013 15 Left 1016257005 6:142119293-142119315 CCAGGATGGGACATATGACTGGG No data
Right 1016257013 6:142119331-142119353 CTAAATAGGACCATATCATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016257005 Original CRISPR CCCAGTCATATGTCCCATCC TGG (reversed) Intergenic
No off target data available for this crispr