ID: 1016257008

View in Genome Browser
Species Human (GRCh38)
Location 6:142119317-142119339
Sequence CAGGATACCCCCATCTAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016257003_1016257008 6 Left 1016257003 6:142119288-142119310 CCACACCAGGATGGGACATATGA No data
Right 1016257008 6:142119317-142119339 CAGGATACCCCCATCTAAATAGG No data
1016257005_1016257008 1 Left 1016257005 6:142119293-142119315 CCAGGATGGGACATATGACTGGG No data
Right 1016257008 6:142119317-142119339 CAGGATACCCCCATCTAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016257008 Original CRISPR CAGGATACCCCCATCTAAAT AGG Intergenic
No off target data available for this crispr