ID: 1016263771

View in Genome Browser
Species Human (GRCh38)
Location 6:142207445-142207467
Sequence GTTCAGCAGTACCATGCTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 2, 1: 11, 2: 31, 3: 65, 4: 168}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016263770_1016263771 -7 Left 1016263770 6:142207429-142207451 CCAAATCAGAATGGCTGTTCAGC 0: 2
1: 28
2: 73
3: 65
4: 138
Right 1016263771 6:142207445-142207467 GTTCAGCAGTACCATGCTGTAGG 0: 2
1: 11
2: 31
3: 65
4: 168
1016263768_1016263771 5 Left 1016263768 6:142207417-142207439 CCAAAGGAGACACCAAATCAGAA 0: 1
1: 13
2: 34
3: 97
4: 323
Right 1016263771 6:142207445-142207467 GTTCAGCAGTACCATGCTGTAGG 0: 2
1: 11
2: 31
3: 65
4: 168
1016263765_1016263771 30 Left 1016263765 6:142207392-142207414 CCAGAAACTTCACTGTGCAACTT 0: 1
1: 0
2: 3
3: 17
4: 220
Right 1016263771 6:142207445-142207467 GTTCAGCAGTACCATGCTGTAGG 0: 2
1: 11
2: 31
3: 65
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016263771 Original CRISPR GTTCAGCAGTACCATGCTGT AGG Intronic
902787012 1:18739214-18739236 GTCCACCATTGCCATGCTGTGGG - Intronic
902845490 1:19107025-19107047 GGGCACCAGTGCCATGCTGTTGG - Intronic
904275289 1:29379820-29379842 ATTAAGCAGCACCATGCTGTAGG - Intergenic
904426565 1:30427628-30427650 GTTCAGCAGCACCACATTGTAGG + Intergenic
907982675 1:59499363-59499385 GTCCAGCAAATCCATGCTGTAGG - Intronic
908660915 1:66434349-66434371 GCTGAGCAGGACCATCCTGTAGG + Intergenic
909460608 1:75908955-75908977 GTACAGCAGCACCATGCTAGAGG - Intronic
911753025 1:101520571-101520593 GTTCAACAGCACCATGTTATAGG - Intergenic
912640665 1:111342537-111342559 GTTCAGCAGTGCAAAGCTGTAGG - Intergenic
912731344 1:112109053-112109075 GTTGAGCAGCACCATGCAGTAGG - Intergenic
915880371 1:159664796-159664818 GTTCAGCAGCACCATGCAGTAGG - Intergenic
916143840 1:161722980-161723002 GTTCTGCAGTTCCAAGCAGTGGG + Exonic
918621033 1:186606102-186606124 GTTCAGCAGCACCGGGCTCTAGG - Intergenic
920930855 1:210386597-210386619 GTTCAGCACTACCAGGATGGAGG - Intronic
921942195 1:220853730-220853752 GTTCAGCAGCACCATGCTGTAGG - Intergenic
922136385 1:222831507-222831529 ATTCAGCAGTTCTAAGCTGTAGG - Intergenic
922504912 1:226120861-226120883 GTTCAGCTGGAGCATGCTGCCGG - Intergenic
923937656 1:238781381-238781403 GTTCAGCACCATCATGCTGTAGG - Intergenic
1063954990 10:11257385-11257407 GTTCAACACTACCATTCTCTGGG - Intronic
1064326888 10:14359554-14359576 ATTCACCATAACCATGCTGTTGG + Intronic
1065496570 10:26335410-26335432 GTTTGGCAGCACCATGCTGTAGG - Intergenic
1066629781 10:37447846-37447868 ATTCACCATAACCATGCTGTTGG - Intergenic
1069804693 10:71112980-71113002 GTTCAGCAGCACCATGCTGTAGG - Intergenic
1070040357 10:72772204-72772226 GTTCAGCAGCACCATGCTGTAGG + Intronic
1070584859 10:77756487-77756509 GTTCAGTAGCACCACACTGTAGG + Intergenic
1072054886 10:91745224-91745246 ATTCAACAGCACCATGCCGTAGG + Intergenic
1072772096 10:98150713-98150735 GTTCAGCAGCACCACGCTGTAGG - Intronic
1074315633 10:112359542-112359564 CTTCAGAAGTACAATTCTGTAGG - Intergenic
1075206860 10:120456449-120456471 GTTCAGCAGCCCCAAGCTGCTGG + Intergenic
1076613349 10:131739932-131739954 ATGCATCAGTACCCTGCTGTGGG + Intergenic
1076613382 10:131740419-131740441 ATGCATCTGTACCATGCTGTGGG + Intergenic
1076926329 10:133490001-133490023 GTTCAGCAGCACCATGCTGTAGG - Intergenic
1080192481 11:29568804-29568826 GTTCAGCAGCACTATGCTGTGGG + Intergenic
1080716995 11:34812505-34812527 GTTCAGCAGCACCATACTGTAGG + Intergenic
1080717698 11:34819771-34819793 TTTCAGCAGTACCCTACTCTTGG + Intergenic
1081040292 11:38201496-38201518 ATTCAGCAGCATCATGCTGTAGG + Intergenic
1082935428 11:58652094-58652116 GCTCAGCAGCACCATGCTATAGG - Intronic
1084511083 11:69604506-69604528 TTTCTGCAATAACATGCTGTGGG + Intergenic
1084901561 11:72313926-72313948 CTTCAGAAGTAACATGATGTGGG + Intronic
1086035960 11:82414702-82414724 TTTTAGCAGCACCATGCTGTAGG + Intergenic
1086552942 11:88073284-88073306 GTTCAACAGAACCATGCTACAGG + Intergenic
1087700239 11:101429244-101429266 CTTCAGCAGGATCATGCTATAGG - Intergenic
1088755887 11:112884839-112884861 GGTCAGCAGTCCCCTTCTGTAGG - Intergenic
1089461906 11:118658633-118658655 GTTCAGGAGTTCCCTGGTGTTGG + Intronic
1092481927 12:8867318-8867340 GTTCAGTAGTACCTTGTTGATGG + Intronic
1092671570 12:10867713-10867735 GTTCAATAGCACCATGCTTTAGG - Intronic
1092941391 12:13410465-13410487 GTTTAGCAGCACCATGCTGTAGG + Intergenic
1093142663 12:15527549-15527571 GTTCAGCAGCACCATACTGTAGG + Intronic
1094471694 12:30807462-30807484 CTTCAGCAGCACCATGCTGTAGG + Intergenic
1095777632 12:46026740-46026762 GTTCAGCAGCACCATGCTGTAGG - Intergenic
1096421385 12:51461238-51461260 GGTCAGCAGTACCATGAGATTGG + Exonic
1097646236 12:62237908-62237930 GTTCAGCAACACCAAGATGTAGG - Intronic
1099434551 12:82627897-82627919 GTTCAGCAGCACCGCACTGTAGG + Intergenic
1100804463 12:98266800-98266822 GTTCAGGAGCCCTATGCTGTAGG + Intergenic
1101364359 12:104058000-104058022 GTTCAGCAGCACCACACTGTAGG - Intronic
1101792611 12:107941592-107941614 GTTCAGCTGCACCATGCAGAAGG + Intergenic
1103502921 12:121418640-121418662 GTTCAGGAGTACGAGGCTGCAGG + Intronic
1105968388 13:25405118-25405140 GTTCAGCAGCAAGAGGCTGTTGG + Intronic
1105981963 13:25526677-25526699 GCTTAGCAGCACCATGCTGTAGG - Intronic
1108560959 13:51643536-51643558 GTTCATCAATACCACCCTGTAGG - Intronic
1108769413 13:53680266-53680288 GTTCAGCAGTACCATGCTGTAGG - Intergenic
1109362711 13:61316845-61316867 GTTCAGCAGCACCATGTGGTAGG - Intergenic
1112480037 13:99766869-99766891 GTTTAGCAGTACCACACTATAGG - Intronic
1112895856 13:104298939-104298961 GGTCAGAACTACCATACTGTAGG + Intergenic
1113286994 13:108860621-108860643 GTGCAGCAGTACACTGTTGTTGG - Intronic
1115279675 14:31647575-31647597 GTTCAGCAGCACCACATTGTAGG - Intronic
1116514007 14:45784434-45784456 GTTTAGCAGCCCTATGCTGTAGG - Intergenic
1116745597 14:48814591-48814613 GTTCAGCAGCACTATGCTGCAGG + Intergenic
1117618067 14:57554473-57554495 GTTCAGCAGCTCCAAGCTATAGG - Intergenic
1118290913 14:64521669-64521691 GTTGTGCAGTACTATGCTGATGG - Exonic
1118547346 14:66906183-66906205 GTTCAGCAGTACCACGCTGTAGG - Intronic
1125365537 15:38911479-38911501 GTTCAGCAGCAGTATGGTGTAGG - Intergenic
1126280953 15:46948740-46948762 GTTAAGTAGGACCATGATGTTGG - Intergenic
1126815858 15:52452561-52452583 GTTCAGCAGTATCATACTGTAGG + Intronic
1127188079 15:56500851-56500873 GTTCAGCAGCATCGTGCTGTAGG + Intergenic
1127252324 15:57253310-57253332 GTGCTGCGGAACCATGCTGTGGG + Exonic
1127739844 15:61892261-61892283 GTTCAGCAGCACAACACTGTGGG + Intronic
1129074505 15:72980835-72980857 GTTCAGCAGTATCATGATACTGG - Intergenic
1130172966 15:81535717-81535739 GTTCAGCAGCTCCAGGCTGTAGG + Intergenic
1132397394 15:101483928-101483950 GTCCAGAAGCACCATGCGGTAGG + Intronic
1137908489 16:52351127-52351149 ACACAGCAGTACAATGCTGTGGG + Intergenic
1139047175 16:63076056-63076078 GTTCAGCAGCACCACAGTGTAGG - Intergenic
1140474350 16:75231743-75231765 CTTCACCAGTCCCCTGCTGTTGG - Intronic
1141058398 16:80840443-80840465 GGACAGCAGTCCCATGCTGAGGG - Intergenic
1141748817 16:85944737-85944759 GATCAGCAGGTCCATCCTGTGGG + Intergenic
1144654193 17:17025039-17025061 TTTCAGCAGGACCATGTGGTTGG - Intergenic
1148142037 17:45335850-45335872 TCTCAGCAGATCCATGCTGTTGG - Intergenic
1148403438 17:47388031-47388053 GTTCAGCAGTACCACACTGTAGG - Intronic
1149186691 17:54006470-54006492 ATTCAGCAGTCCCATTCTGATGG - Intergenic
1149636273 17:58172488-58172510 GTCCAGCAGCACCATGCTGTAGG + Intergenic
1149949355 17:60968732-60968754 GTTCAGCAGCACCATGTAGTAGG - Intronic
1151756690 17:76079306-76079328 GTTCAGCATTACCTTGCTGTTGG + Exonic
1151841923 17:76625121-76625143 GTTCTTCAGTACATTGCTGTAGG - Exonic
1151897877 17:76992511-76992533 GCTCAGCAGAACCTTGCTTTAGG - Intergenic
1152607785 17:81301743-81301765 GTGCAGCAGACCCATGCTCTTGG - Intergenic
1155011917 18:21787319-21787341 GTTCAGCAGCACTATACTGCAGG - Intronic
1155113702 18:22742621-22742643 GTTCAGCAGCACCACACTGTAGG + Intergenic
1155978007 18:32152761-32152783 GTTCAGCAGCACCACACTGTAGG - Intronic
1157813134 18:50711901-50711923 GATCACCAGTACCATGTTGTGGG + Intronic
1157887240 18:51380692-51380714 GTTCAGCTGGAACATGATGTTGG + Intergenic
1157917472 18:51680319-51680341 GTTCAGCACCACCAGGCTGTAGG + Intergenic
1159705663 18:71683378-71683400 GTCCAGTAGTTCCATGCTGTAGG + Intergenic
1160602324 18:80023077-80023099 GTTAATCAGTCCCATTCTGTGGG - Intronic
1162265753 19:9572560-9572582 GTTCAGGAGCACCATACTGTAGG + Intronic
1164484544 19:28643550-28643572 GTCCAGCAGTCCCCTGCTTTTGG + Intergenic
1165566185 19:36730293-36730315 GTTCAGCAGCAGCATGCTGTAGG + Intronic
1166623122 19:44322856-44322878 GTTCAGCATCACTATACTGTAGG - Intergenic
1166974736 19:46599313-46599335 GTTCGTTAGCACCATGCTGTGGG - Intronic
925418675 2:3692707-3692729 GTTCAGCAACACCATGTTGTAGG - Intronic
926132469 2:10312937-10312959 GTTGAGAAGCACCATGATGTTGG - Intronic
926610848 2:14945083-14945105 GTTCAGCAGCACCAAGCTGCCGG + Intergenic
926875397 2:17471139-17471161 GTTCAGCAGCACAATGCTGTAGG - Intergenic
927160594 2:20255269-20255291 GTTCTGCAGTGCAATGCTCTAGG + Exonic
927523830 2:23719904-23719926 GTTAAGCAGCGCCATGCTGTAGG + Intergenic
929082963 2:38139292-38139314 GTTCACCAATACCCTGCTGCAGG - Intergenic
930032754 2:47068590-47068612 GTTCTGCAGGCCCATGGTGTGGG + Intronic
930858753 2:56047228-56047250 GTTCAGCAGCACCTTGCTGGTGG + Intergenic
932609056 2:73185187-73185209 GTTCAGCAGCACCATCCTCTTGG - Intergenic
933460214 2:82573659-82573681 ATTCAGCTGTACCATGCTGTAGG - Intergenic
936851567 2:116905229-116905251 ATTAAGCAGCACCATCCTGTAGG - Intergenic
939080410 2:137654297-137654319 GTTCAGCAGTACCACGCTGTAGG - Intronic
939847586 2:147267534-147267556 ATTCAGCAGCACCACACTGTAGG - Intergenic
940612405 2:156007195-156007217 GTTCAGCATTACCCTGATGCAGG + Intergenic
941477870 2:165970774-165970796 GCTCACCAGCACCATGCTGTAGG + Intergenic
941589913 2:167406761-167406783 ACTCAGCAACACCATGCTGTCGG + Intergenic
943102479 2:183505172-183505194 GTTCAGCAGCATCATGCTGTTGG - Intergenic
943602563 2:189939210-189939232 TTTCAGTGGCACCATGCTGTAGG + Intronic
943659505 2:190543260-190543282 GTTCATCAGCACTGTGCTGTCGG - Intergenic
943752327 2:191522969-191522991 GTTCATCAGTGCCCTGCGGTGGG - Intergenic
944277691 2:197858002-197858024 GTTCAACAGCCCCATGATGTAGG - Intronic
945676680 2:212863470-212863492 GTTCAGCAGCATCACCCTGTAGG - Intergenic
946025587 2:216669999-216670021 GCTCAGCAGTGCCATGCAGGAGG + Intergenic
947305386 2:228740634-228740656 GTACAGCAGCACCATGCTCTAGG - Intergenic
948739962 2:240039849-240039871 GTTCAGCAGCACCATGCTGTAGG - Intergenic
1170863492 20:20130774-20130796 GTTCAGCAGCACCACACTGTAGG - Intronic
1171427090 20:25056130-25056152 GTTCAGAAGGTCCTTGCTGTTGG + Intronic
1171508347 20:25658171-25658193 GTTCACCAGCACCATGCTGTAGG - Intergenic
1173303262 20:41823295-41823317 GTTCAGCAGTGTCATGTTGGTGG + Intergenic
1174224862 20:48989581-48989603 GTTCTGGAGTCCGATGCTGTAGG - Exonic
1178359871 21:31939854-31939876 GTTAAGCAGAACCAGGGTGTGGG - Intronic
1179451075 21:41468835-41468857 GTTCAGCAGAACCAAGCCGTTGG - Intronic
1180575980 22:16774916-16774938 GTGCAGCAGTACCATGAGGTAGG - Intergenic
1180607975 22:17075547-17075569 GTTAAGCAGCACCATGTGGTAGG - Intergenic
1180825268 22:18857054-18857076 GGTCAGCACTGCCGTGCTGTGGG - Intronic
1181187461 22:21117493-21117515 GGTCAGCACTGCCGTGCTGTGGG + Intergenic
1181211737 22:21293000-21293022 GGTCAGCACTGCCGTGCTGTGGG - Intergenic
1181397771 22:22633886-22633908 GGTCAGCACTGCCGTGCTGTGGG + Intergenic
1181651640 22:24262172-24262194 GGTCAGCACTGCCATGCTGTGGG - Intergenic
1184150628 22:42636332-42636354 GTCCAGTAGTACCAGGCTGTGGG + Intronic
1184327470 22:43800124-43800146 TTTCAGCAGTCACATGCTGTAGG + Intronic
1203215216 22_KI270731v1_random:2432-2454 GGTCAGCACTGCCGTGCTGTGGG + Intergenic
1203275417 22_KI270734v1_random:82957-82979 GGTCAGCACTGCCGTGCTGTGGG - Intergenic
949856927 3:8470363-8470385 TTTCAGCAGTCCCATCTTGTAGG - Intergenic
952884899 3:38006296-38006318 GCCCATCAGGACCATGCTGTCGG - Intronic
952972684 3:38662633-38662655 GTTCAGCAGCAACACACTGTAGG + Intergenic
954946997 3:54434641-54434663 GCTCAGCAGTAGCAGGCTGGTGG + Intronic
955395226 3:58552470-58552492 GTTCAGCAGCACCATGCTGTAGG - Intergenic
957515884 3:81250413-81250435 GTTTACCAGTACCATCCTGCAGG - Intergenic
957655641 3:83070537-83070559 GTTTACCAGTACCACACTGTAGG + Intergenic
957777482 3:84772546-84772568 GTTTAGTAGAACCATACTGTTGG + Intergenic
958825627 3:99026825-99026847 GTTCAGCAGAACTGTCCTGTAGG + Intergenic
960749171 3:120927326-120927348 GTTCAGCAGTATCATGCTATAGG - Intronic
962497928 3:135961580-135961602 GTTCAGCAGCAACATGATGTAGG - Intergenic
962763309 3:138538286-138538308 GTTCAGCAGCACCACACTGTAGG + Intronic
963888026 3:150602932-150602954 TTTCAGCATTACCATTCTGAGGG + Exonic
964803543 3:160581213-160581235 GCTCAGCAGCAACATGCTGTAGG + Intergenic
965008542 3:163056753-163056775 GTTAATCAGTCCCATTCTGTGGG - Intergenic
965867386 3:173221343-173221365 GTTCAGCAGCACCATATAGTAGG - Intergenic
965884629 3:173429869-173429891 GTTCAGCAGCAACATGCTTTAGG - Intronic
967282535 3:187836053-187836075 GAGAAGAAGTACCATGCTGTGGG + Intergenic
967688822 3:192449461-192449483 GTTCCACAGCACCCTGCTGTCGG + Intronic
968205341 3:196794734-196794756 GTTCAGCAACACCATGTTGTAGG + Intronic
968719086 4:2186380-2186402 GGTCAGTAGGACCATGTTGTAGG + Intronic
969473823 4:7409399-7409421 GTTCAGCAGCACCATGCTGTTGG - Intronic
970866938 4:20770095-20770117 GTTCAGAAGAAGCAGGCTGTGGG - Intronic
971797346 4:31244696-31244718 ATTCAGCAGCACCACACTGTAGG + Intergenic
973950425 4:56007449-56007471 GTTCAGTAACAACATGCTGTAGG - Intronic
976833890 4:89348173-89348195 GTTCAGCAGTATCATGCTGTAGG - Intergenic
978316266 4:107440905-107440927 GGTCAACTGTACCATGCTTTAGG - Intergenic
978888217 4:113791234-113791256 GTTCAGCAGCCCTATGCTGTAGG + Intergenic
980066209 4:128191628-128191650 GTTCAGCAGGACCACACTGTAGG - Intronic
980868045 4:138576758-138576780 ATTCAGCAGCACCATGCTGTAGG + Intergenic
981159554 4:141481723-141481745 GTTCAGCAGCAGTATGCTGTAGG - Intergenic
981894160 4:149777617-149777639 CTTGAGGAGTACCATGCTTTTGG - Intergenic
981900692 4:149858378-149858400 ATTCAGCAGCACCATGCTGTAGG + Intergenic
982114233 4:152083939-152083961 TTTCAGCAATGGCATGCTGTGGG - Intergenic
983655622 4:170080587-170080609 GTTCAGCAGCACCACACTGCAGG + Intronic
984521249 4:180803753-180803775 TTCCAGCAGCACAATGCTGTTGG - Intergenic
986341963 5:6796883-6796905 GCTCAACAGAACCATGCTCTTGG - Intergenic
986536771 5:8796287-8796309 GTTCCTCAATACCATGCTGGTGG + Intergenic
988412975 5:30910922-30910944 ATTCAGCAGGAACAAGCTGTTGG - Intergenic
991011596 5:61888409-61888431 GTTCAGCAGCACCACACTTTAGG + Intergenic
992654976 5:78900202-78900224 ATTCAGCAGCACCACACTGTAGG - Intronic
993037733 5:82775569-82775591 GTTCAGAAGTACCATTGCGTGGG - Intergenic
993241020 5:85385463-85385485 ATTTAGCAGCAGCATGCTGTAGG - Intergenic
993414202 5:87605843-87605865 ATTCAGCAGTACCAACCTGTAGG - Intergenic
993920063 5:93790681-93790703 GCTCAGCAGTGCCACGCTGGGGG + Intronic
993936795 5:94014183-94014205 GTTCATCAGTATCACACTGTAGG + Intronic
994317561 5:98349724-98349746 GCTTAGCAGTACCATGCTGTAGG + Intergenic
995278792 5:110308861-110308883 GTTTAGCAGCACCATACTGTAGG + Intronic
995553124 5:113300016-113300038 GTGCACCAACACCATGCTGTGGG + Intronic
995827534 5:116317395-116317417 GTTCAACAGCAACATGCTGTAGG - Intronic
996113454 5:119592340-119592362 GTTCTGCAGCACCATGCTGTAGG + Intronic
996217233 5:120884224-120884246 GTTCAGCAGTCACATGTGGTTGG - Intergenic
997523031 5:134535407-134535429 TTCCAGGAGGACCATGCTGTCGG - Intronic
997759273 5:136429382-136429404 ATTCAGAAATACCATCCTGTGGG + Intergenic
998580700 5:143372416-143372438 GTTCAGCATCTCCATGCTGTAGG - Intronic
999412402 5:151363277-151363299 GTTCAGCAGCACCACACTGTAGG - Intergenic
1000806111 5:165794824-165794846 GTTCATCAGAACCATGCTGTGGG - Intergenic
1003079623 6:3010744-3010766 GTTCAGCAGCACCACACTGTAGG + Intronic
1003642265 6:7886087-7886109 GTTGAGCAGGGCCATGCTTTGGG + Intronic
1004009253 6:11666208-11666230 ATTCAGCAGTACCAAGATGTTGG + Intergenic
1005063794 6:21798601-21798623 GTCCAGCAGTTCCAGGCTGCAGG - Intergenic
1007040805 6:38720357-38720379 GTTTGGCAGTACCATGCTGTGGG + Intronic
1007288545 6:40766130-40766152 AGGCAGCAGTACAATGCTGTGGG - Intergenic
1007514641 6:42401375-42401397 TTTCAGCCCTACTATGCTGTAGG + Intronic
1007825256 6:44595235-44595257 GGTCAGCAGGACAATGGTGTAGG - Intergenic
1007861731 6:44916922-44916944 GTTCAGGAGTTCAAGGCTGTGGG + Intronic
1013184005 6:107741586-107741608 GTTACGCAGTACCACACTGTAGG + Intronic
1015216856 6:130760076-130760098 ATTCAGCAGCACCATGCTATAGG + Intergenic
1016263771 6:142207445-142207467 GTTCAGCAGTACCATGCTGTAGG + Intronic
1016615356 6:146041622-146041644 GTTCAGCAGCACCACATTGTAGG - Intronic
1017186425 6:151605412-151605434 GTTCAGCAGGACCACACTGTAGG - Intronic
1017934132 6:158989534-158989556 GTTCAGCAGCACCACATTGTAGG - Intronic
1019131338 6:169879117-169879139 GTTCAGCAGCACGAGGCTATAGG - Intergenic
1020466161 7:8482101-8482123 GTTCAGCAGTTTCACTCTGTTGG - Intronic
1021771830 7:24010811-24010833 GTTCAGCAGCACCACACTGTAGG - Intergenic
1025040637 7:55641525-55641547 GTTCAGTAACACCATGCTGTAGG - Intergenic
1028560362 7:92168460-92168482 ATTCAGCAGCACCATGCTGTAGG + Intronic
1032867092 7:135936732-135936754 AATCAGCAGAATCATGCTGTAGG - Intronic
1036659554 8:10699222-10699244 GGCCAGCAGTGCCATGCTGGAGG - Intronic
1036824786 8:11967637-11967659 GTTCTGCAATTCCCTGCTGTGGG - Intergenic
1037282772 8:17261814-17261836 ATTCAGCAGCTCCATGTTGTAGG - Intronic
1039627396 8:39068252-39068274 GTTCAGCTGTATCATCCTATAGG - Intronic
1040764930 8:50897363-50897385 ATTCAGCAGTACCATGAAGGCGG + Intergenic
1040774350 8:51021295-51021317 GTTCAGCATCACCATGCTATAGG + Intergenic
1041981199 8:63862432-63862454 CATCAGCACTACCATCCTGTAGG - Intergenic
1041996126 8:64060515-64060537 GTTCAGGAGCACCGTTCTGTAGG + Intergenic
1043033125 8:75164249-75164271 GTTCGGCAGCACCATGCTGAAGG - Intergenic
1044407584 8:91846564-91846586 ATTCAGCAGTATCATGCTATAGG + Intergenic
1048080114 8:131117764-131117786 GTTGAGCTGCACCATGCTATAGG - Intergenic
1049039288 8:140100024-140100046 GTTCCGCAGTCCCTTGCTCTAGG - Intronic
1049953590 9:670597-670619 GTTCGGCAGCACTATGCTGTAGG - Intronic
1050268752 9:3919074-3919096 GGTCAGCAGTACCATCCAGTTGG - Intronic
1050841821 9:10158979-10159001 GTTCAGCAGCACCATGTTGTAGG + Intronic
1052689544 9:31800037-31800059 GTTCAGCAGCACCATGCTATAGG + Intergenic
1052734671 9:32328812-32328834 GTTCAGCAGCACCGTGCTGTAGG + Intergenic
1053898915 9:42773426-42773448 TTCCTGCAGTACAATGCTGTTGG + Intergenic
1055557331 9:77488527-77488549 GTTCAGCAGCATCACTCTGTAGG + Intronic
1055854765 9:80672222-80672244 CTACAGCAGTACTATGATGTGGG + Intergenic
1056295739 9:85191339-85191361 GTTAGGAAATACCATGCTGTAGG - Intergenic
1056424953 9:86466698-86466720 GTTCATCAGTACCATGCACCAGG - Intergenic
1057296303 9:93845023-93845045 GTTCACCAGCACCATGCTGTAGG - Intergenic
1060166955 9:121425315-121425337 GTTCAGCAGCACCACGCTGTGGG + Intergenic
1061323662 9:129849011-129849033 GTTCAGCAGGCCCAGGCTGCAGG - Intronic
1186994719 X:15107692-15107714 GGTCAGCAGCATCATACTGTAGG - Intergenic
1187714226 X:22086212-22086234 GTTCAGCAGCATTATGCTATAGG - Intronic
1187941406 X:24386331-24386353 GTTCAGCAGCACCGTGTTGTAGG - Intergenic
1187982528 X:24773424-24773446 GTTCTTCTGTACCATACTGTGGG + Intronic
1188382018 X:29506675-29506697 ATTCAGCAGTACTATACTGTAGG - Intronic
1188479026 X:30618444-30618466 GCTCAGCAGCACCATGCTATAGG + Intergenic
1188903135 X:35759739-35759761 GTTCAGTAGCACCACACTGTAGG - Intergenic
1189798917 X:44674065-44674087 TTTCAGCAGGGCCATGCTGAAGG + Intergenic
1190223787 X:48530300-48530322 GTGCAGTAGTGCCATGATGTTGG - Intergenic
1192521931 X:71809823-71809845 GTTCAGCAGCGCCACACTGTAGG - Intergenic
1192760769 X:74094172-74094194 TTTCAGCAGCACCATGCTGGAGG + Intergenic
1193178247 X:78420874-78420896 GTTCAGCACCACCATGTTGTAGG + Intergenic
1194530037 X:95035917-95035939 GTTCATCAGCACCATGCTGTAGG - Intergenic
1194613656 X:96074847-96074869 ATTCAGCAGCATCATGTTGTAGG + Intergenic
1195073568 X:101304636-101304658 GTTCAGCAGCATCATGCTGTAGG - Intergenic
1196882779 X:120213718-120213740 GTTTAGCAGCACCACACTGTAGG + Intergenic
1196980928 X:121212942-121212964 GGTCAGCAGCACCATGCTACAGG - Intergenic
1197260612 X:124313209-124313231 GTTCAGCAGCACCACACTGCAGG + Intronic
1199194821 X:145016010-145016032 ATTCAGCAGCACCATGCTATAGG + Intergenic
1199245045 X:145593953-145593975 GTTCAGCAGCAGCATGCTATAGG + Intergenic
1202343890 Y:23900810-23900832 GTGCAGCATTACCATGGGGTAGG - Intergenic
1202526878 Y:25769274-25769296 GTGCAGCATTACCATGGGGTAGG + Intergenic