ID: 1016263771

View in Genome Browser
Species Human (GRCh38)
Location 6:142207445-142207467
Sequence GTTCAGCAGTACCATGCTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 2, 1: 11, 2: 31, 3: 65, 4: 168}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016263770_1016263771 -7 Left 1016263770 6:142207429-142207451 CCAAATCAGAATGGCTGTTCAGC No data
Right 1016263771 6:142207445-142207467 GTTCAGCAGTACCATGCTGTAGG 0: 2
1: 11
2: 31
3: 65
4: 168
1016263765_1016263771 30 Left 1016263765 6:142207392-142207414 CCAGAAACTTCACTGTGCAACTT 0: 1
1: 0
2: 3
3: 17
4: 220
Right 1016263771 6:142207445-142207467 GTTCAGCAGTACCATGCTGTAGG 0: 2
1: 11
2: 31
3: 65
4: 168
1016263768_1016263771 5 Left 1016263768 6:142207417-142207439 CCAAAGGAGACACCAAATCAGAA No data
Right 1016263771 6:142207445-142207467 GTTCAGCAGTACCATGCTGTAGG 0: 2
1: 11
2: 31
3: 65
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016263771 Original CRISPR GTTCAGCAGTACCATGCTGT AGG Intronic